OriGene Logo

PSMD7 (NM_002811) Human 3' UTR Clone

Be the first to review this product
SKU
SC207611
3' UTR clone of proteasome (prosome macropain) 26S subunit non-ATPase 7 (PSMD7) for miRNA target validation
  $683.00
4 Weeks*
Size
Bulk Requests & Clone Modifications

Frequently Bought Together (2)

CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA) 5 x 200 ul
$160.00
PR300001 Firefly luciferase assay kit, 150 assays 1 kit
$215.00

Other products for "PSMD7 or NM_002811"

Specifications
Specifications
Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Target Symbol PSMD7
Synonyms MOV34; P40; Rpn8; S12
ACCN NM_002811
Insert Size 585 bp
Sequence Data
Insert Sequence
>SC207611 3’UTR clone of NM_002811
The sequence shown below is from the reference sequence of NM_002811. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
AAGAAAGAGGAGAAAAAGGAGAAAAAGTAAAACATGTATTAAATAGCTTTTTTAATTTGTAAATTAAAA
TCTTACAAACTAAATCAGTGTGCTGCTAGAGGGTTCTTTTTCACTTGACATGCTTATTAGAAAGCTGAC
CCAACAAGAGCTCTCTGCCTCCGGTCACTCTTGCTGTGGTGCTACGTGGAAGTGAATGGAGACTGATCT
CAAATCTGAACTGCAGCTTTCGCTGCTGTGAGTTGGGGATATGATAGTCAGCTCAGGCTTCAGATTGTA
TGAGAAAAATGAAGAGAAGTCAACAAATATTTTGGTACTCTTCATTCATTTATCTCTAAAACCAGGAGT
TGAATTTTCCTCATCTTGAAAGACTCTTGGGGTCTGTTTCTGGTATTTTACAAAATTGCTAAGTGGAAT
GCATGAATTGCATTATGTTCTCTGGTAACACGTAGAGTTCAGACCCTTCTGAACTCTGTTGATAATACC
ACACCATGTTCTGGACCCATAGCTCTGGCATCCTCAGGGGTTGTGATCCAGCTCCATATATTGTTTACC
TTCAAAGATACAATTAAATGGCTTGATTTTTAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI |
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_002811.5
Locus ID 5713
Summary The 26S proteasome is a multicatalytic proteinase complex with a highly ordered structure composed of 2 complexes, a 20S core and a 19S regulator. The 20S core is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. The 19S regulator is composed of a base, which contains 6 ATPase subunits and 2 non-ATPase subunits, and a lid, which contains up to 10 non-ATPase subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. This gene encodes a non-ATPase subunit of the 19S regulator. A pseudogene has been identified on chromosome 17. provided by RefSeq, Jul 2008
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Documents
Resources

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.