OriGene Logo

CREM (NM_001881) Human 3' UTR Clone

Be the first to review this product
SKU
SC207591
3' UTR clone of cAMP responsive element modulator (CREM) transcript variant 2 for miRNA target validation
  $683.00
4 Weeks*
Size
Bulk Requests & Clone Modifications

Frequently Bought Together (2)

CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA) 5 x 200 ul
$160.00
PR300001 Firefly luciferase assay kit, 150 assays 1 kit
$215.00

Other products for "CREM or NM_001881"

Specifications
Specifications
Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Target Symbol CREM
Synonyms CREM-2; hCREM-2; ICER
ACCN NM_001881
Insert Size 548 bp
Sequence Data
Insert Sequence
>SC207591 3’UTR clone of NM_001881
The sequence shown below is from the reference sequence of NM_001881. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GATACAGTGCTAGCTTTAAGTCTTCTCTAGTTATATTGAAGCAACTCAGGTTTTGGCATTAAATTGTTC
CATTTTAAAATGCATCATTAATACCTAAACTGTATCATAGAATGAAAGTATATGTTAAAAAGTGAGATC
TTTGTATTGACAGCTGTCATATAATTTTGAAAAGTAAAAATTTTGACTGCCGAATATAGAAGAAAATTT
TGGGGTAAAAAGGAGAATTTTTCCTATTTACATGTTTATATTAATCTCTAGTAAAACATTGTTTTTGTT
GTCTTTATGATGCATGCGAACATAAATGTCTGTATTTCATTCTTGTTGGCTTTTGTTACCCACAATTAC
ATACTATTCTTACTAATCTGAGAGTTTTCTAAAGTATGTTTTCAATGTTTCACTACTCTCTACTCTGTT
AATTTGTGCTACAGTTTTTCCTAAAAGAGAATGGAAAAATGATTTAATTTTTTAAACTGTAGCAATTGG
ATAGATAATTTTATTTGAAATTTTACACACTGAAAGCTCTAAATAAACAGATACATTCACATTCA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI |
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001881.4
Locus ID 1390
Summary This gene encodes a bZIP transcription factor that binds to the cAMP responsive element found in many viral and cellular promoters. It is an important component of cAMP-mediated signal transduction during the spermatogenetic cycle, as well as other complex processes. Alternative promoter and translation initiation site usage allows this gene to exert spatial and temporal specificity to cAMP responsiveness. Multiple alternatively spliced transcript variants encoding several different isoforms have been found for this gene, with some of them functioning as activators and some as repressors of transcription. provided by RefSeq, Jul 2008
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Documents
Resources

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.