cadherin 10 (CDH10) (NM_006727) Human 3' UTR Clone

SKU
SC207535
3' UTR clone of cadherin 10 type 2 (T2-cadherin) (CDH10) for miRNA target validation
  $683.00
4 Weeks*
Specifications
Specifications
Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Target Symbol cadherin 10
ACCN NM_006727
Insert Size 593 bp
Sequence Data
Insert Sequence
>SC207535 3’UTR clone of NM_006727
The sequence shown below is from the reference sequence of NM_006727. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GGTGGTGGGGAAAGTGACAAAGACTCTTAACGTAGGATATATGTTCTGTTCAAACAAGAGAAAGTAACT
CTACCCATGCTGTCTCCACTTCACAATATTTGATATTCAGGAGCATTTTCCTGCCAGTCAGCACAATTT
TTTTTCTCATTTACTTCTTAATTTGTTCATTAATTACATTAATTCTTTCCTGTAGGATGTCTCATGGAA
TATATATGACATTTTATTTAATCACTTCCAAGAGCCAAAGCTATGGAAATACAGTGTTGTCCATCTTAG
TAAATAAAAGATAATTTCAGAAACATGAACAGGATAGTTCTCCCTTAAGCAACCTCACAAACAAGCCGC
TTCTGTTAGGTACATGTCCTGCCCTTGCAAATGAAGCTTTTAAAAAGGTGAAGAAAAATTTTACAGTAT
ATCCTGTTCTGTACATTAAATTAAAAAAACAAAAATGTACATGTGATGTTAGTAGGTGTGATATGCAAC
CTGGTATACAGACATTTGTGCAATTTCATTTCATCAAATTCTATCTGCTAATGTTTTATATTTATATTT
TTGTATTTATTTTTAAAAAAATAAACCAGTTTTTACAACTA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI |
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_006727.5
Locus ID 1008
Summary This gene encodes a type II classical cadherin of the cadherin superfamily. Alternative splicing of this gene results in multiple transcript variants. At least one of these variants encodes a preproprotein that is proteolytically processed to generate the mature cadherin protein. These integral membrane proteins mediate calcium-dependent cell-cell adhesion and are composed of a large N-terminal extracellular domain, a single membrane-spanning domain, and a small, highly conserved C-terminal cytoplasmic domain. The extracellular domain consists of 5 subdomains, each containing a cadherin motif, and appears to determine the specificity of the protein's homophilic cell adhesion activity. Type II (atypical) cadherins are defined based on their lack of a histidine-alanine-valine (HAV) cell adhesion recognition sequence specific to type I cadherins. This particular cadherin is predominantly expressed in brain and is putatively involved in synaptic adhesions, axon outgrowth and guidance. Mutations in this gene may be associated with lung squamous cell carcinoma and colorectal cancer in human patients. provided by RefSeq, Nov 2015
Reviews
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Documents
Resources

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.