OriGene Logo

ST14 (NM_021978) Human 3' UTR Clone

Be the first to review this product
SKU
SC207486
3' UTR clone of suppression of tumorigenicity 14 (colon carcinoma) (ST14) for miRNA target validation
  $683.00
4 Weeks*
Size
Bulk Requests & Clone Modifications

Frequently Bought Together (2)

CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA) 5 x 200 ul
$160.00
PR300001 Firefly luciferase assay kit, 150 assays 1 kit
$215.00

Other products for "ST14 or NM_021978"

Specifications
Specifications
Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Target Symbol ST14
Synonyms ARCI11; CAP3; HAI; MT-SP1; MTSP1; PRSS14; SNC19; TADG15; TMPRSS14
ACCN NM_021978
Insert Size 569 bp
Sequence Data
Insert Sequence
>SC207486 3’UTR clone of NM_021978
The sequence shown below is from the reference sequence of NM_021978. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GACTGGATCAAAGAGAACACTGGGGTATAGGGGCCGGGGCCACCCAAATGTGTACACCTGCGGGGCCAC
CCATCGTCCACCCCAGTGTGCACGCCTGCAGGCTGGAGACTGGACCGCTGACTGCACCAGCGCCCCCAG
AACATACACTGTGAACTCAATCTCCAGGGCTCCAAATCTGCCTAGAAAACCTCTCGCTTCCTCAGCCTC
CAAAGTGGAGCTGGGAGGTAGAAGGGGAGGACACTGGTGGTTCTACTGACCCAACTGGGGGCAAAGGTT
TGAAGACACAGCCTCCCCCGCCAGCCCCAAGCTGGGCCGAGGCGCGTTTGTGCATATCTGCCTCCCCTG
TCTCTAAGGAGCAGCGGGAACGGAGCTTCGGGGCCTCCTCAGTGAAGGTGGTGGGGCTGCCGGATCTGG
GCTGTGGGGCCCTTGGGCCACGCTCTTGAGGAAGCCCAGGCTCGGAGGACCCTGGAAAACAGACGGGTC
TGAGACTGAAATTGTTTTACCAGCTCCCAGGGTGGACTTCAGTGTGTGTATTTGTGTAAATGAGTAAAA
CATTTTATTTCTTTTTA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI |
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_021978.4
Locus ID 6768
Summary The protein encoded by this gene is an epithelial-derived, integral membrane serine protease. This protease forms a complex with the Kunitz-type serine protease inhibitor, HAI-1, and is found to be activated by sphingosine 1-phosphate. This protease has been shown to cleave and activate hepatocyte growth factor/scattering factor, and urokinase plasminogen activator, which suggest the function of this protease as an epithelial membrane activator for other proteases and latent growth factors. The expression of this protease has been associated with breast, colon, prostate, and ovarian tumors, which implicates its role in cancer invasion, and metastasis. provided by RefSeq, Jul 2008
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Documents
Resources

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.