OriGene Logo

ALDH1A1 (NM_000689) Human 3' UTR Clone

Be the first to review this product
SKU
SC207472
3' UTR clone of aldehyde dehydrogenase 1 family member A1 (ALDH1A1) for miRNA target validation
  $683.00
4 Weeks*
Size
Bulk Requests & Clone Modifications

Frequently Bought Together (2)

CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA) 5 x 200 ul
$160.00
PR300001 Firefly luciferase assay kit, 150 assays 1 kit
$215.00

Other products for "ALDH1A1 or NM_000689"

Specifications
Specifications
Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Target Symbol ALDH1A1
Synonyms ALDC; ALDH-E1; ALDH1; ALDH11; HEL-9; HEL-S-53e; HEL12; PUMB1; RALDH1
ACCN NM_000689
Insert Size 567 bp
Sequence Data
Insert Sequence
>SC207472 3’UTR clone of NM_000689
The sequence shown below is from the reference sequence of NM_000689. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
ACAGTGAAAATCTCTCAGAAGAACTCATAAAGAAAATACAAGAGTGGAGAGAAGCTCTTCAATAGCTAA
GCATCTCCTTACAGTCACTAATATAGTAGATTTTAAAGACAAAATTTTTCTTTTCTTGATTTTTTTAAA
CATAAGCTAAATCATATTAGTATTAATACTACCCATAGAAAACTTGACATGTAGCTTCTTCTGAAAGAA
TTATTTGCCTTCTGAAATGTGACCCCCAAGTCCTATCCTAAATAAAAAAAGACAAATTCGGATGTATGA
TCTCTCTAGCTTTGTCATAGTTATGTGATTTTCCTTTGTAGCTACTTTTGCAGGATAATAATTTTATAG
AAAAGGAACAGTTGCATTTAGCTTCTTTCCCTTAGTGACTCTTGAAGTACTTAACATACACGTTAACTG
CAGAGTAAATTGCTCTGTTCCCAGTAGTTATAAAGTCCTTGGACTGTTTTGAAAAGTTTCCTAGGATGT
CATGTCTGCTTGTCAAAAGAAATAATCCCTGTAATATTTAGCTGTAAACTGAATATAAAGCTTAATAAA
AACAACCTTGCATGA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI |
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_000689.5
Locus ID 216
Summary The protein encoded by this gene belongs to the aldehyde dehydrogenase family. Aldehyde dehydrogenase is the next enzyme after alcohol dehydrogenase in the major pathway of alcohol metabolism. There are two major aldehyde dehydrogenase isozymes in the liver, cytosolic and mitochondrial, which are encoded by distinct genes, and can be distinguished by their electrophoretic mobility, kinetic properties, and subcellular localization. This gene encodes the cytosolic isozyme. Studies in mice show that through its role in retinol metabolism, this gene may also be involved in the regulation of the metabolic responses to high-fat diet. [provided by RefSeq, Mar 2011]
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Documents
Resources

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.