TAB1 (NM_153497) Human 3' UTR Clone

SKU
SC207454
3' UTR clone of mitogen-activated protein kinase kinase kinase 7 interacting protein 1 (MAP3K7IP1) transcript variant beta for miRNA target validation
  $683.00
4 Weeks*
Specifications
Specifications
Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Target Symbol TAB1
Synonyms 3'-Tab1; MAP3K7IP1
ACCN NM_153497
Insert Size 591 bp
Sequence Data
Insert Sequence
>SC207454 3’UTR clone of NM_153497
The sequence shown below is from the reference sequence of NM_153497. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
AACCTCCTGGGCAGCCTGACCCCAGGGTAGGAAGGAAGCGCCTACACCAAGGGGCCCTCTGGGAGCTGA
GATCATCCTGGGGTTTTGTCGCCTGGTCTGACTTGTGCACTGGGATCTTCTCGTGCCAGGCCAGGCCCC
GCCCCCTCCCCGGGACTGGGCAGACCCCCTCCCTCATGCATCTGTGTCCACTGAGGCTTCCCTCACCTA
GAATGGCCCATCCTTCAGGACCCAGCTCACTCTCATCTTCTTTCCAGGGACTTATCCCCCAAGGCTGTC
CTCTGTTCTGGTGAGCTCAGGGCTCTTGGAACTTGGTCTGCAGTGACTCTGGGGTTCCTGGTTAGGACC
CATGTTCTCTAGGTCCCAGCACCCTGCACGGGGCAGTGTTTGTGACACTGGGCCCAGCTATTCTGAGAG
AAGGACTCCAACCTTCCATCAGGTGTGGCCCGAGATGTGGGTGGCCCTGGGCATGGGGCATGGATGCAT
TGTGACTTTCATGGGCCTCTTCTGCAAAAAAAAAATTAAAATTATACTTTATGACTATTGGTAGAAAGA
TAAATATATTAATACATTAAAATTTCTCTTTGAGTAAAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI |
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_153497.3
Locus ID 10454
Summary The protein encoded by this gene was identified as a regulator of the MAP kinase kinase kinase MAP3K7/TAK1, which is known to mediate various intracellular signaling pathways, such as those induced by TGF beta, interleukin 1, and WNT-1. This protein interacts and thus activates TAK1 kinase. It has been shown that the C-terminal portion of this protein is sufficient for binding and activation of TAK1, while a portion of the N-terminus acts as a dominant-negative inhibitor of TGF beta, suggesting that this protein may function as a mediator between TGF beta receptors and TAK1. This protein can also interact with and activate the mitogen-activated protein kinase 14 (MAPK14/p38alpha), and thus represents an alternative activation pathway, in addition to the MAPKK pathways, which contributes to the biological responses of MAPK14 to various stimuli. Alternatively spliced transcript variants encoding distinct isoforms have been reported. provided by RefSeq, Jul 2008
Reviews
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Documents
Resources

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.