OriGene Logo

WFDC1 (NM_021197) Human 3' UTR Clone

Be the first to review this product
SKU
SC207451
3' UTR clone of WAP four-disulfide core domain 1 (WFDC1) for miRNA target validation
  $683.00
4 Weeks*
Size
Bulk Requests & Clone Modifications

Frequently Bought Together (2)

CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA) 5 x 200 ul
$160.00
PR300001 Firefly luciferase assay kit, 150 assays 1 kit
$215.00

Other products for "WFDC1 or NM_021197"

Specifications
Specifications
Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Target Symbol WFDC1
Synonyms PS20
ACCN NM_021197
Insert Size 568 bp
Sequence Data
Insert Sequence
>SC207451 3’UTR clone of NM_021197
The sequence shown below is from the reference sequence of NM_021197. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GGAAGGGGACAACAGAAGCACTTTCAGTAAAGCAACGGCAAGCAGCTAGGTTGCAAGAACATTCCTCTA
CTTTCTGCTAAGCCTTGGAAACAGTTGGGAAAAGTAGTTTGACCCTCACAGTTCACATTCAGCTCAGCA
GAGCAAGACCCCAGAGATGCTTAGAGACAGGACACCTGGCCATCAAACCCAGTTTGGCCCAGCCTGGTT
GGGTGACTTTGTGGGAGCCACTTAACAGCTCTGGGTCCCTGTTTTACCATCCTGGGAGCAAGGCCCTGC
AGCTCCACGAGACCTTTACCCCGGGAAGAAGCCGCCACCCATGAAAGCATTTCTGAAGCCCCTTTCTAA
GACAAGGCTCAGCATCTTGATATTTTTGACAGATTCCTCCCAAGTCTGGCTCTGGGAGGTATGTACCCA
TCTCAAATGTTCCCAAGATAAATTCATCCTTCAGGAAATGGAAATGAACTTGCTTACTAATGTGTGATT
CCTAGTTGTAGCCACCGGATGTGCTGAGGCCTAAATGTTAGCAGGTGGGAGGAGGCCACAGAACAATAA
AAACAACCAAATAAGA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI |
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_021197.4
Locus ID 58189
Summary This gene encodes a member of the WAP-type four disulfide core domain family. The WAP-type four-disulfide core domain contains eight cysteines forming four disulfide bonds at the core of the protein, and functions as a protease inhibitor in many family members. This gene is mapped to chromosome 16q24, an area of frequent loss of heterozygosity in cancers, including prostate, breast and hepatocellular cancers and Wilms' tumor. This gene is downregulated in many cancer types and may be involved in the inhibition of cell proliferation. The encoded protein may also play a role in the susceptibility of certain CD4 memory T cells to human immunodeficiency virus infection. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2013]
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Documents
Resources

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.