OriGene Logo

PIK3R6 (NM_001010855) Human 3' UTR Clone

Be the first to review this product
SKU
SC207449
3' UTR clone of phosphoinositide-3-kinase regulatory subunit 6 (PIK3R6) for miRNA target validation
  $683.00
4 Weeks*
Size
Bulk Requests & Clone Modifications

Frequently Bought Together (2)

CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA) 5 x 200 ul
$160.00
PR300001 Firefly luciferase assay kit, 150 assays 1 kit
$215.00

Other products for "PIK3R6 or NM_001010855"

Specifications
Specifications
Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Target Symbol PIK3R6
Synonyms C17orf38; HsT41028; p84 PIKAP; p87(PIKAP); p87PIKAP
ACCN NM_001010855
Insert Size 581 bp
Sequence Data
Insert Sequence
>SC207449 3’UTR clone of NM_001010855
The sequence shown below is from the reference sequence of NM_001010855. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
ATCAACACATTCTCTGGTATTGTCCAGTGAGCCTGCAGGGACAGCAGGCCCAGGAGGAAGGATACACTA
CCCCACCAACTCCAAACACTCACACCAACAGCCAGAGCAAGGCCCGGCTCCACACGGCAGCTTTGGCCT
TGACCAGGAGCCAGCGAGTGCCTGGGAGCACAGGGAGCCTACCCTGGGGACTGTGATGAGGAAGGGCCC
ACATGGAGGTCTACGGATGGCCCAGGCAATGCTGTCGCTGCTTGAGAACATACACACCAAGCCCAGCTT
CTCATACAAATGTCTACTCCTTCATTTAGCTTCAATTCCCACTTCTCCCACTGTCCTCTCCCACCCAAG
CTCCCCATCCAGCCCTTAAAACCAGGGTTAAAGCTGCTGTCTTGGCCAGAGCCCTGTGGCCTAGGGGAA
AATTGGAAGCAAGGAACAGCAACAGCACCACCTCCCTCCCAAGTCTCTTCCCTTCCCACTCTCAGGCCA
CTGCCCACCTCACTCAGCCCAGGCAGGTGTCTCTATCAGGTGAGAGAAAAATGTCAGACTCAATAAATG
TACACTGAAGTCTTTCTGCTTTCATCTCA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI |
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001010855.4
Locus ID 146850
Summary Phosphoinositide 3-kinase gamma is a lipid kinase that produces the lipid second messenger phosphatidylinositol 3,4,5-trisphosphate. The kinase is composed of a catalytic subunit and one of several regulatory subunits, and is chiefly activated by G protein-coupled receptors. This gene encodes a regulatory subunit, and is distantly related to the phosphoinositide-3-kinase, regulatory subunit 5 gene which is located adjacent to this gene on chromosome 7. The orthologous protein in the mouse binds to both the catalytic subunit and to G(beta/gamma), and mediates activation of the kinase subunit downstream of G protein-coupled receptors. Alternative splicing results in multiple transcript variants. provided by RefSeq, Feb 2014
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Documents
Resources

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.