OriGene Logo

HIVEP1 (NM_002114) Human 3' UTR Clone

Be the first to review this product
SKU
SC207444
3' UTR clone of human immunodeficiency virus type I enhancer binding protein 1 (HIVEP1) for miRNA target validation
  $683.00
4 Weeks*
Size
Bulk Requests & Clone Modifications

Frequently Bought Together (2)

CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA) 5 x 200 ul
$160.00
PR300001 Firefly luciferase assay kit, 150 assays 1 kit
$215.00

Other products for "HIVEP1 or NM_002114"

Specifications
Specifications
Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Target Symbol HIVEP1
Synonyms CIRIP; CRYBP1; GAAP; MBP-1; PRDII-BF1; Schnurri-1; ZAS1; ZNF40; ZNF40A
ACCN NM_002114
Insert Size 568 bp
Sequence Data
Insert Sequence
>SC207444 3’UTR clone of NM_002114
The sequence shown below is from the reference sequence of NM_002114. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GACGAGGACAGGCTTGTGATAGCAACCTGATGGATTTTATTTTTTATTTGCTTTTTTTTTATATAACAC
TTAAAGGTTTCTTTGAAAACCCTCCTTTCCTTAAAGCACATTTTTCTGACATAAACTCATGACTAATCT
TTGTGCAATCATGAACTTTTGACCAATAATTGTTGTTTTGTGTCAGCTCCAGCCATTTTTGTACATGTT
GTATAGACAATTGTGCCTTTTAGGAGCTTTATGTTTAGAAACTGTACAGATTGTTGAATATCTATATAC
ATAAAAATATATTATATATGTATATGAAAACCAGGTAGTTATTTGTGTTTAGTAAGGAAAACCTGTCAA
ATAAATCAAATGATTAAATTATATGTTCCACTGTTGAATATAAATTTTATGGCTATGGGGCAGAGTTTC
TGTGTATAAATTAGTATGTAAACTCCATATTTATTGTATTCATATTAGTCTTTGAAAATGGGTCTGTCC
TCCTTGTGTAAGACAGTAACTTTACACTTCAGACAGATTTTCTGTGTTATGAAATGTTTCAGTAAAATA
TTGTTTACTGACTTTA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI |
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_002114.4
Locus ID 3096
Summary This gene encodes a transcription factor belonging to the ZAS family, members of which are large proteins that contain a ZAS domain - a modular protein structure consisting of a pair of C2H2 zinc fingers with an acidic-rich region and a serine/threonine-rich sequence. These proteins bind specifically to the DNA sequence motif, GGGACTTTCC, found in the enhancer elements of several viral promoters, including human immunodeficiency virus (HIV), and to related sequences found in the enhancer elements of a number of cellular promoters. This protein binds to this sequence motif, suggesting a role in the transcriptional regulation of both viral and cellular genes. provided by RefSeq, Oct 2011
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Documents
Resources

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.