OriGene Logo

MEMO1 (NM_001137602) Human 3' UTR Clone

Be the first to review this product
SKU
SC207441
3' UTR clone of mediator of cell motility 1 (MEMO1) transcript variant 2 for miRNA target validation
  $683.00
4 Weeks*
Size
Bulk Requests & Clone Modifications

Frequently Bought Together (2)

CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA) 5 x 200 ul
$160.00
PR300001 Firefly luciferase assay kit, 150 assays 1 kit
$215.00

Other products for "MEMO1 or NM_001137602"

Specifications
Specifications
Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Target Symbol MEMO1
Synonyms C2orf4; CGI-27; MEMO; NS5ATP7
ACCN NM_001137602
Insert Size 568 bp
Sequence Data
Insert Sequence
>SC207441 3’UTR clone of NM_001137602
The sequence shown below is from the reference sequence of NM_001137602. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
TATGCAGCTGGAGCACTCACGGTCCACTGAAGCTCTGAATCCTCAGGGATGCCACCTGCACATTCTCAT
ACTCTGTCCGGGGTCCCAGCCTAGCCTTTACCACGATACTGGTCCTGGTTTGGGGGGATTCTGAAACCT
CAAACTAATAGAACTTTCTTCTCTTTTTTTCTAGTAGGTGTAGTCCTTCCTTAATTTCAACTCATTAAA
AAATGCTTTATAGTTTAGGGCAGTGGAAGGAAGGCTGGCATCAAAATATTTTGATCAAAAAAGATGACA
ATGTAAAGGCTCAGTTGTGGCAGACAGTTTTTTGAAAGTAACTTGTAAAGCATTTACCATATCCTAAAT
TTGCACTCTTTGCAGACTTGTGCACATATATTCCGCTTTCAGAATAGTTTTGCAAATTGTACACAAACA
AACAAAAAGGTGGAAGCTTTTTAATAAAGAAATTGCATTTATAAATGATCTGTATTAGAATATAATAAA
TCTCCAGTTATAGTCAATTACTACCCATGTTGTACAACAGATACCTTCTATTTTAGTTGCTAATAAAGG
GCTACACAACTCAAAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI |
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001137602.4
Locus ID 51072
Summary May control cell migration by relaying extracellular chemotactic signals to the microtubule cytoskeleton. Mediator of ERBB2 signaling. The MEMO1-RHOA-DIAPH1 signaling pathway plays an important role in ERBB2-dependent stabilization of microtubules at the cell cortex. It controls the localization of APC and CLASP2 to the cell membrane, via the regulation of GSK3B activity. In turn, membrane-bound APC allows the localization of the MACF1 to the cell membrane, which is required for microtubule capture and stabilization. Is required for breast carcinoma cell migration.[UniProtKB/Swiss-Prot Function]
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Documents
Resources

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.