G protein beta subunit like (MLST8) (NM_022372) Human 3' UTR Clone

SKU
SC207438
3' UTR clone of MTOR associated protein LST8 homolog (S. cerevisiae) (MLST8) for miRNA target validation
  $683.00
4 Weeks*
Specifications
Specifications
Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Target Symbol G protein beta subunit like
Synonyms GbetaL; GBL; LST8; POP3; WAT1
ACCN NM_022372
Insert Size 606 bp
Sequence Data
Insert Sequence
>SC207438 3’UTR clone of NM_022372
The sequence shown below is from the reference sequence of NM_022372. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CTGGCCTTCAATGACAGTGTGCTGGGCTAGCCTGTGACCCCTCGGGACTGCCTGGTGCAGGTGGTGGCA
GCTGGAGGGACCCATGCAGCACCCAGGTCAGAGCAGACCCTCCCCTGCCGGCCTGCGCCAGCTGGACCT
GATGGCCCCCTGTGGCGCCTTGACCTGCTGGGCCAGGCTGCCCTGGGACTCTCAGCCCCCAGTTGCTTA
TCCAGATGTGACAGAGCTCGACCCAAGCCAGGCTGCACACTCCTGGACTGGGCTAGCCTGCACTGCCTG
GGAAAGTCGGCCGAGGGCCCAAAGCTGCTGAGGGGTCTGAGGCTGGTGCCCACCCCCAAGCTAGTGTGT
TCTCTGCCCCTCCCTGCCCGCGTTTCAGGGCCTCGGTCCATAGAGAACACCACCACCATGGCCAGGTGG
AAGGGTTTATTAGTCCCTGCCAGCAGCTGTCCTCCCTGGTGCAGGTGGCCTGGCCAGCCCACTGGATTG
GGGACGGGCCAGGCTGGGCCAGGTCGGGGGCTCAGTCTGGGAGGTAATAAAAGCAGACCGACACGCAGA
TGTTGCTCGGGAAGCAGATGTCGATGCAGAGATAAATCAGCCGCTGTCTCCGGG
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI |
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_022372.6
Locus ID 64223
Summary Subunit of both mTORC1 and mTORC2, which regulates cell growth and survival in response to nutrient and hormonal signals. mTORC1 is activated in response to growth factors or amino acids. Growth factor-stimulated mTORC1 activation involves a AKT1-mediated phosphorylation of TSC1-TSC2, which leads to the activation of the RHEB GTPase that potently activates the protein kinase activity of mTORC1. Amino acid-signaling to mTORC1 requires its relocalization to the lysosomes mediated by the Ragulator complex and the Rag GTPases. Activated mTORC1 up-regulates protein synthesis by phosphorylating key regulators of mRNA translation and ribosome synthesis. mTORC1 phosphorylates EIF4EBP1 and releases it from inhibiting the elongation initiation factor 4E (eiF4E). mTORC1 phosphorylates and activates S6K1 at 'Thr-389', which then promotes protein synthesis by phosphorylating PDCD4 and targeting it for degradation. Within mTORC1, LST8 interacts directly with MTOR and enhances its kinase activity. In nutrient-poor conditions, stabilizes the MTOR-RPTOR interaction and favors RPTOR-mediated inhibition of MTOR activity. mTORC2 is also activated by growth factors, but seems to be nutrient-insensitive. mTORC2 seems to function upstream of Rho GTPases to regulate the actin cytoskeleton, probably by activating one or more Rho-type guanine nucleotide exchange factors. mTORC2 promotes the serum-induced formation of stress-fibers or F-actin. mTORC2 plays a critical role in AKT1 'Ser-473' phosphorylation, which may facilitate the phosphorylation of the activation loop of AKT1 on 'Thr-308' by PDK1 which is a prerequisite for full activation. mTORC2 regulates the phosphorylation of SGK1 at 'Ser-422'. mTORC2 also modulates the phosphorylation of PRKCA on 'Ser-657'.UniProtKB/Swiss-Prot Function
Reviews
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Documents
Resources

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.