XRCC4 (NM_022550) Human 3' UTR Clone

SKU
SC207435
3' UTR clone of X-ray repair complementing defective repair in Chinese hamster cells 4 (XRCC4) transcript variant 3 for miRNA target validation
  $683.00
4 Weeks*
Specifications
Specifications
Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Target Symbol XRCC4
Synonyms SSMED
ACCN NM_022550
Insert Size 548 bp
Sequence Data
Insert Sequence
>SC207435 3’UTR clone of NM_022550
The sequence shown below is from the reference sequence of NM_022550. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
AGCCCAGAAGACCTCTTTGATGAGATTTAACAGTCTCAAAAAATACTTTGATGTTCACTAGACTATGTT
TTCTATTCATTTCTTTAAAATGAAAAAGGAGAATTTCAAGTCAGCAGCCGCTATTACCGTATCTTACAA
TTTAATTACATACACAGTGAATTGAAACCATTGTGCAAAATGGATTACACATGTATACAAAGATACGAT
TTGATGATGACACTGGCACATTATTCTAAACTATTCATTCAGCATGCCTATAATTACATAAATTGTATG
AGACTTTTTGTTGCAAAGGACACATTTATCATATTCATTCACACATATTATATGTGATAGCTGTCCAAC
ATCCTGTCTGGGAAGATTTTGAAAACAGGACAAAGAAAACATCATTTTAAAATGTCTTCAGCTTTTTTT
GAATAGACGTATTCAAACATATTCTGAACATTGATGTTTGAACATTTTAATTTGTGTGATGATGTAGAA
AATATAATTTTAGTTTGTACATAAACATTGTGAAAATCTGATAATAAAATTTTTGATACATTGAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI |
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_022550.4
Locus ID 7518
Summary The protein encoded by this gene functions together with DNA ligase IV and the DNA-dependent protein kinase in the repair of DNA double-strand breaks. This protein plays a role in both non-homologous end joining and the completion of V(D)J recombination. Mutations in this gene can cause short stature, microcephaly, and endocrine dysfunction (SSMED). Alternate transcript variants such as NM_022406 are unlikely to be expressed in some individuals due to a polymorphism (rs1805377) in the last splice acceptor site. provided by RefSeq, Oct 2019
Reviews
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Documents
Resources

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.