CNAP1 (NCAPD2) (NM_014865) Human 3' UTR Clone

SKU
SC207432
3' UTR clone of non-SMC condensin I complex subunit D2 (NCAPD2) for miRNA target validation
  $683.00
4 Weeks*
Specifications
Specifications
Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Target Symbol CNAP1
Synonyms CAP-D2; CNAP1; hCAP-D2; MCPH21
ACCN NM_014865
Insert Size 573 bp
Sequence Data
Insert Sequence
>SC207432 3’UTR clone of NM_014865
The sequence shown below is from the reference sequence of NM_014865. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
AGAGCATCGGCTCGCAGGCACAGATCCTAGGAAGTCTGTTCCTGTCCTCCCTGTGCAGGGTATCCTGTA
GGGTGACCTGGAATTCGAATTCTGTTTCCCTTGTAAAATATTTGTCTGTCTCTTTTTTTTAAAAAAAAA
AAAGGCCGGGCACTGTGGCTCACGCCTGTAATCCCAGCACTTTGCGATACCAAGGCGGGTGGATAACCT
GAGGTAGGGAGTTCGAGACCAGCCTGACCAACATGGAGAAACCCCATCTCTACTAAAAATAAAAAATTA
GCCGGGCGTATTGGCGTGCGCCTGTAATCCCAGCTACTCAAGAGGCTGAGGCAGGAGAATCGCCTGAAC
CCAGAGGCGGAGGTTGTAGTGAGCCGAAATCACACCATTGCACTCCAGCTTGGGCAACAATAGCGAACC
TCCATCTCAAATTAAAAAAAAAATGCCTACACGCTCTTTAAAATGCAAGGCTTTCTCTTAAATTAGCCT
AACTGAACTGCGTTGAGCTGCTTCAACTTTGGAATATATGTTTGCCAATCTCCTTGTTTTCTAATGAAT
AAATGTTTTTATATACTTTTA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI |
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_014865.4
Locus ID 9918
Summary Regulatory subunit of the condensin complex, a complex required for conversion of interphase chromatin into mitotic-like condense chromosomes. The condensin complex probably introduces positive supercoils into relaxed DNA in the presence of type I topoisomerases and converts nicked DNA into positive knotted forms in the presence of type II topoisomerases. May target the condensin complex to DNA via its C-terminal domain (PubMed:11136719). May promote the resolution of double-strand DNA catenanes (intertwines) between sister chromatids. Condensin-mediated compaction likely increases tension in catenated sister chromatids, providing directionality for type II topoisomerase-mediated strand exchanges toward chromatid decatenation. Required for decatenation of non-centromeric ultrafine DNA bridges during anaphase. Early in neurogenesis, may play an essential role to ensure accurate mitotic chromosome condensation in neuron stem cells, ultimately affecting neuron pool and cortex size (PubMed:27737959).UniProtKB/Swiss-Prot Function
Reviews
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Documents
Resources

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.