OriGene Logo

Myoferlin (MYOF) (NM_013451) Human 3' UTR Clone

Be the first to review this product
SKU
SC207389
3' UTR clone of myoferlin (MYOF) transcript variant 1 for miRNA target validation
  $683.00
4 Weeks*
Size
Bulk Requests & Clone Modifications

Frequently Bought Together (2)

CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA) 5 x 200 ul
$160.00
PR300001 Firefly luciferase assay kit, 150 assays 1 kit
$215.00

Other products for "Myoferlin or NM_013451"

Specifications
Specifications
Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Target Symbol Myoferlin
Synonyms FER1L3; HAE7
ACCN NM_013451
Insert Size 564 bp
Sequence Data
Insert Sequence
>SC207389 3’UTR clone of NM_013451
The sequence shown below is from the reference sequence of NM_013451. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
TCAATGAAGATTGTAAAGCCAAATGTGTAACAAAGGCAAAGGCTTCATTTCAAGAGTCATCCAGCAATG
AGAGAATCCTGCCTCTGTAGACCAACATCCAGTGTGATTTTGTGTCTGAGACCACACCCCAGTAGCAGG
TTACGCCATGTCACCGAGCCCCATTGATTCCCAGAGGGTCTTAGTCCTGGAAAGTCAGGCCAACAAGCA
ACGTTTGCATCATGTTATCTCTTAAGTATTAAAAGTTTTATTTTCTAAAGTTTAAATCATGTTTTTCAA
AATATTTTTCAAGGTGGCTGGTTCCATTTAAAAATCATCTTTTTATATGTGTCTTCGGTTCTAGACTTC
AGCTTTTGGAAATTGCTAAATAGAATTCAAAAATCTCTGCATCCTGAGGTGATATACTTCATATTTGTA
ATCAACTGAAAGAGCTGTGCATTATAAAATCAGTTAGAATAGTTAGAACAATTCTTATTTATGCCCACA
ACCATTGCTATATTTTGTATGGATGTCATAAAAGTCTATTTAACCTCTGTAATGAAACTAAATAAAAAT
GTTTCACCTTTA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI |
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_013451.4
Locus ID 26509
Summary Mutations in dysferlin, a protein associated with the plasma membrane, can cause muscle weakness that affects both proximal and distal muscles. The protein encoded by this gene is a type II membrane protein that is structurally similar to dysferlin. It is a member of the ferlin family and associates with both plasma and nuclear membranes. The protein contains C2 domains that play a role in calcium-mediated membrane fusion events, suggesting that it may be involved in membrane regeneration and repair. Two transcript variants encoding different isoforms have been found for this gene. Other possible variants have been detected, but their full-length nature has not been determined. [provided by RefSeq, Dec 2008]
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Documents
Resources

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.