OriGene Logo

Angiopoietin like 4 (ANGPTL4) (NM_001039667) Human 3' UTR Clone

Be the first to review this product
SKU
SC207382
3' UTR clone of angiopoietin-like 4 (ANGPTL4) transcript variant 3 for miRNA target validation
  $683.00
4 Weeks*
Size
Bulk Requests & Clone Modifications

Frequently Bought Together (2)

CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA) 5 x 200 ul
$160.00
PR300001 Firefly luciferase assay kit, 150 assays 1 kit
$215.00

Other products for "Angiopoietin like 4 or NM_001039667"

Specifications
Specifications
Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Target Symbol Angiopoietin like 4
Synonyms ARP4; FIAF; HARP; HFARP; NL2; PGAR; pp1158; TGQTL; UNQ171
ACCN NM_001039667
Insert Size 514 bp
Sequence Data
Insert Sequence
>SC207382 3’UTR clone of NM_001039667
The sequence shown below is from the reference sequence of NM_001039667. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CAGCCCATGGCAGCAGAGGCAGCCTCCTAGCGTCCTGGCTGGGCCTGGTCCCAGGCCCACGAAAGACGG
TGACTCTTGGCTCTGCCCGAGGATGTGGCCGTTCCCTGCCTGGGCAGGGGCTCCAAGGAGGGGCCATCT
GGAAACTTGTGGACAGAGAAGAAGACCACGACTGGAGAAGCCCCCTTTCTGAGTGCAGGGGGGCTGCAT
GCGTTGCCTCCTGAGATCGAGGCTGCAGGATATGCTCAGACTCTAGAGGCGTGGACCAAGGGGCATGGA
GCTTCACTCCTTGCTGGCCAGGGAGTTGGGGACTCAGAGGGACCACTTGGGGCCAGCCAGACTGGCCTC
AATGGCGGACTCAGTCACATTGACTGACGGGGACCAGGGCTTGTGTGGGTCGAGAGCGCCCTCATGGTG
CTGGTGCTGTTGTGTGTAGGTCCCCTGGGGACACAAGCAGGCGCCAATGGTATCTGGGCGGAGCTCACA
GAGTTCTTGGAATAAAAGCAACCTCAGAACA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI |
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001039667.3
Locus ID 51129
Summary This gene encodes a glycosylated, secreted protein containing a C-terminal fibrinogen domain. The encoded protein is induced by peroxisome proliferation activators and functions as a serum hormone that regulates glucose homeostasis, lipid metabolism, and insulin sensitivity. This protein can also act as an apoptosis survival factor for vascular endothelial cells and can prevent metastasis by inhibiting vascular growth and tumor cell invasion. The C-terminal domain may be proteolytically-cleaved from the full-length secreted protein. Decreased expression of this gene has been associated with type 2 diabetes. Alternative splicing results in multiple transcript variants. This gene was previously referred to as ANGPTL2 but has been renamed ANGPTL4. [provided by RefSeq, Sep 2013]
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Documents
Resources

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.