AUH (NM_001698) Human 3' UTR Clone

SKU
SC207329
3' UTR clone of AU RNA binding protein/enoyl-Coenzyme A hydratase (AUH) nuclear gene encoding mitochondrial protein for miRNA target validation
  $683.00
4 Weeks*
Specifications
Specifications
Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Target Symbol AUH
ACCN NM_001698
Insert Size 555 bp
Sequence Data
Insert Sequence
>SC207329 3’UTR clone of NM_001698
The sequence shown below is from the reference sequence of NM_001698. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
AAAAGGCCCCCTCGCTATAAAGGAGAATAAAAGGAACAGAAATTCTTAAGATGCCAATGTAATAAATGT
ACTTCCTGGAAGTGTCTTTCGGATCCACTATATGCCTCAGCACATGGAACCTTAATGACCAAAGTGAAG
AGCAGATTATTCATACGGTGTAATAAGCATCTGGAATGGACCCATCCGTGTACTTCATTCAAATGTGTA
AATGTCATATTCATTCAGATTTATAAAGCTAGTAGTGTATAGTCAGAAACAGAATCAAAGTTAGATATA
CATTTTTAAATATTTACTGCATATGAGGCTTTCTGTTAATTTTTTAATGTGAATAATTTATATATTGCA
CATTCTAGGGAATAATATTGATTGTATGTCTACTGTGCTGCATTAAGAAAATAAAATTTCTATATACCA
AAAATGTGAAGTTATACCAAATAAAGTTTCTAAGTGATTAATGCATACGAACAGCTACATATACATATA
TCTAAACCTGAAAAATGAATTGATATTCTGAGTGAAAACTACCTAATATAAATAAAATTAGTGAAAAGA
AAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI |
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001698.3
Locus ID 549
Summary This gene encodes bifunctional mitochondrial protein that has both RNA-binding and hydratase activities. The encoded protein is a methylglutaconyl-CoA hydratase that catalyzes the hydration of 3-methylglutaconyl-CoA to 3-hydroxy-3-methyl-glutaryl-CoA, a critical step in the leucine degradation pathway. This protein also binds AU-rich elements (AREs) found in the 3' UTRs of rapidly decaying mRNAs including c-fos, c-myc and granulocyte/ macrophage colony stimulating factor. ARE elements are involved in directing RNA to rapid degradation and deadenylation. This protein is localizes to the mitochondrial matrix and the inner mitochondrial membrane and may be involved in mitochondrial protein synthesis. Mutations in this gene are the cause of 3-methylglutaconic aciduria, type I. Alternative splicing results in multiple transcript variants. provided by RefSeq, Sep 2015
Reviews
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Documents
Resources

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.