OriGene Logo

SFRS5 (SRSF5) (NM_006925) Human 3' UTR Clone

Be the first to review this product
SKU
SC207300
3' UTR clone of splicing factor arginine/serine-rich 5 (SFRS5) transcript variant 2 for miRNA target validation
  $683.00
4 Weeks*
Size
Bulk Requests & Clone Modifications

Frequently Bought Together (2)

CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA) 5 x 200 ul
$160.00
PR300001 Firefly luciferase assay kit, 150 assays 1 kit
$215.00

Other products for "SFRS5 or NM_006925"

Specifications
Specifications
Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Target Symbol SFRS5
Synonyms HRS; SFRS5; SRP40
ACCN NM_006925
Insert Size 574 bp
Sequence Data
Insert Sequence
>SC207300 3’UTR clone of NM_006925
The sequence shown below is from the reference sequence of NM_006925. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
AGGTCCAGATCAGTTGACAGTGGCAATTAAACTGTAAATAACTTGCCCTGGGGGCCTTTTTTTAAAAAA
CAAAAACCACAAAAATTCCCAAACCATACTTGCTAAAAATTCTGGTAAGTATGTGCTTTTCTGTGGGGG
TGGGATTTGGAAGGGGGGTTGGGTTGGGCTGGATATCTTTGTAGATGTGGACCACCAAGGGGTTGTTGA
AAACTAATTGTATTAAATGTCTTTTGATAAGCCTTCTGCTCACATTTTTGTGAATGTCTGAAGTATATA
GTTTGTGTATATTGACAGAGCTCTTTTATAACTAAAGCAAATTTAATTTTTTTGTACTAGAAAAAAATT
TGAACATTTTAGTTCTTGGTTATAAAAATGTTAATTCAGAATTAGTTTAATGCCTTAATTAAACTAATT
AATAGCTTTGGACACTTAAAAGAGCTCTAAATTTGCTTGTACATAAAGGCTTAATTTGTTTTCCTTGTT
AGGGTCAAGGGTGTCCTCCACTCTTTAACAGCTGCTGGACAGACACATTAGAGCAGCTGTTTGTTATTG
ATAATAAAATATTATAAAACTA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI |
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_006925.5
Locus ID 6430
Summary The protein encoded by this gene is a member of the serine/arginine (SR)-rich family of pre-mRNA splicing factors, which constitute part of the spliceosome. Each of these factors contains an RNA recognition motif (RRM) for binding RNA and an RS domain for binding other proteins. The RS domain is rich in serine and arginine residues and facilitates interaction between different SR splicing factors. In addition to being critical for mRNA splicing, the SR proteins have also been shown to be involved in mRNA export from the nucleus and in translation. Alternative splicing results in multiple transcript variants. provided by RefSeq, Feb 2016
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Documents
Resources

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.