OriGene Logo

DOCK2 (NM_004946) Human 3' UTR Clone

Be the first to review this product
SKU
SC207296
3' UTR clone of dedicator of cytokinesis 2 (DOCK2) for miRNA target validation
  $683.00
4 Weeks*
Size
Bulk Requests & Clone Modifications

Frequently Bought Together (2)

CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA) 5 x 200 ul
$160.00
PR300001 Firefly luciferase assay kit, 150 assays 1 kit
$215.00

Other products for "DOCK2 or NM_004946"

Specifications
Specifications
Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Target Symbol DOCK2
Synonyms IMD40
ACCN NM_004946
Insert Size 554 bp
Sequence Data
Insert Sequence
>SC207296 3’UTR clone of NM_004946
The sequence shown below is from the reference sequence of NM_004946. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
ATCCCAGACTCGCTGTCCACGGACCTGTGAGCTGCTGCTGACTAGGGCTGCATGGGAGAGCCAGGGAGG
GGAGTTTCTGGAAGAGGAAAGCCATGCGTGGAACATCGAAGCCTCAGAGAGTGGGAGACTGTCCCCATC
AGTTGTCCTTACTTAGAGGAGACAGAGAGGCCAATCAGGTCCCAGAGCTTGAATGCTAACAAGCCCAGC
ATCCCCTGGGGCTGTGATCATGGTGGATGAGGAAGCCTCAACGTAGATTCCTGAACTCAAGGTACCAGC
AAGAATGCCTTCTCCCAGTGTGCTCTCCCCAACATCCTAGGCACAGCTTTCATAACCCAGTTTCTTAGG
TGTAAGAAACTGTTTTTATCTCATTTATTAAGTCTCAGAACTTAACAGAAAAGGAAGCCTTTTAAATAT
TCTTTTTAATTTTATTTTAGATTAACAGTTTTGTACTTTACATTTTTTTATACAACCAACCAGTTTCTT
TTCTAGCCAATCATCTCTGAAGAGTTGCTGTTTCTTACTGACAATAAAAAATGTTCTCTTGGTTCGAAT
AA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI |
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_004946.3
Locus ID 1794
Summary The protein encoded by this gene belongs to the CDM protein family. It is specifically expressed in hematopoietic cells and is predominantly expressed in peripheral blood leukocytes. The protein is involved in remodeling of the actin cytoskeleton required for lymphocyte migration in response to chemokine signaling. It activates members of the Rho family of GTPases, for example RAC1 and RAC2, by acting as a guanine nucleotide exchange factor (GEF) to exchange bound GDP for free GTP. Mutations in this gene result in immunodeficiency 40 (IMD40), a combined form of immunodeficiency that affects T cell number and function, also with variable defects in B cell and NK cell function. [provided by RefSeq, May 2018]
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Documents
Resources

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.