OriGene Logo

SNRNP25 (NM_024571) Human 3' UTR Clone

Be the first to review this product
SKU
SC207277
3' UTR clone of small nuclear ribonucleoprotein 25kDa (U11/U12) (SNRNP25) for miRNA target validation
  $683.00
4 Weeks*
Size
Bulk Requests & Clone Modifications

Frequently Bought Together (2)

CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA) 5 x 200 ul
$160.00
PR300001 Firefly luciferase assay kit, 150 assays 1 kit
$215.00

Other products for "SNRNP25 or NM_024571"

Specifications
Specifications
Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Target Symbol SNRNP25
Synonyms C16orf33
ACCN NM_024571
Insert Size 556 bp
Sequence Data
Insert Sequence
>SC207277 3’UTR clone of NM_024571
The sequence shown below is from the reference sequence of NM_024571. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
TCCTTCATCAAAAAGCTGAGGCAAAAGTGAGCCTCCAGACAGGACAACCCTCTTCATCACTGGTGGCTG
AGCTTTTTCCCAGCAGGAATGGGTCCTCGAATCATCGTGCCTCTTTCACAGAAAGGACGTTGTGGTGGC
CTCACCCCAGGCATGCCCAACAGTAACTGTCAGCATAAACCTGGGGGCCCTCAGGACTAGGACAGGGTG
AGCCAGTGCTCCCTCCTTTCATGTACTTGGCCTGAGACTGACCTCTCCCTAGGTCCAAATGCCCTAGTC
ACATGGCAGACCCACGGCCTGGCCCACTGTATAAAATAAACCTGTTTGCTTCTTAGTTTGAAAAGTAGA
AAGCCACAGTAACCTGGGTAGCAAAGACTGAGATTGCCCCATCACAGAGGTGAGTTAAGGGGAGAGAAT
TGGTACAGGCGAGTCCTATAGTCCAAGATGGCGCCACACCACCAAAGCCTTGAGGCCACACCACTCCCC
AAACCACACAACTGTGTTACCATGATCTCCACAGCAAGGAGGAAATAAAAGCAGAGCGGCTTTAGGGTT
TGCA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI |
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_024571.4
Locus ID 79622
Summary Two types of spliceosomes catalyze splicing of pre-mRNAs. The major U2-type spliceosome is found in all eukaryotes and removes U2-type introns, which represent more than 99% of pre-mRNA introns. The minor U12-type spliceosome is found in some eukaryotes and removes U12-type introns, which are rare and have distinct splice consensus signals. The U12-type spliceosome consists of several small nuclear RNAs and associated proteins. This gene encodes a 25K protein that is a component of the U12-type spliceosome. provided by RefSeq, Apr 2010
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Documents
Resources

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.