GABARAPL2 (NM_007285) Human 3' UTR Clone

SKU
SC207260
3' UTR clone of GABA(A) receptor-associated protein-like 2 (GABARAPL2) for miRNA target validation
  $683.00
4 Weeks*
Specifications
Specifications
Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Target Symbol GABARAPL2
Synonyms ATG8; ATG8C; GATE-16; GATE16; GEF-2; GEF2
ACCN NM_007285
Insert Size 542 bp
Sequence Data
Insert Sequence
>SC207260 3’UTR clone of NM_007285
The sequence shown below is from the reference sequence of NM_007285. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
TACAGCGGAGAGAACACTTTTGGCTTCTGAGGGCCATTGCTGGGCTAGGTGCACCGTAACTGCTTGTGT
ATCTTGTAAATAGCCAGCCATTTTCAGTTATTATACCAGAACCTCTTCACATAGACCTATTAGTGCATT
TGTAACTGGATTTATTTCTTAATATATTGGAAGGTTTTGTTTCCTTAGACTAGTAAATTATCATACAGA
GTTTTATTTTGAGTTTTTCTTTTTGTGCATTGTCCTCATGCCTGTATTCTCCAGGAAACTTGTCCTTCT
GGAAATCATATTGAATGATATTTCTATATCGAAGTGAGGTAGGTGCGGTATTAAAGTGAAAGGGAAGGT
GATGCATTTATTCTGGGTTATGCTTGAAGTGTTAGATGGCTAAGTATTAAAATTATCCAAATTAAATCC
TTAGCAGTCAGAACACTTGCTTCACTAGAATATGCCAACTGCCAATCATGTTGGACTGAGCTAATTTGT
TCCTCTTTCTGAAACTATTAAGGTAAATAATTAACAATAAAAATTCTCTTATAAAGGCA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI |
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_007285.7
Locus ID 11345
Summary Ubiquitin-like modifier involved in intra-Golgi traffic. Modulates intra-Golgi transport through coupling between NSF activity and SNAREs activation. It first stimulates the ATPase activity of NSF which in turn stimulates the association with GOSR1 (By similarity). Involved in autophagy. Plays a role in mitophagy which contributes to regulate mitochondrial quantity and quality by eliminating the mitochondria to a basal level to fulfill cellular energy requirements and preventing excess ROS production. Whereas LC3s are involved in elongation of the phagophore membrane, the GABARAP/GATE-16 subfamily is essential for a later stage in autophagosome maturation.[UniProtKB/Swiss-Prot Function]
Reviews
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Documents
Resources

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.