OGG1 (NM_016826) Human 3' UTR Clone

SKU
SC207238
3' UTR clone of 8-oxoguanine DNA glycosylase (OGG1) nuclear gene encoding mitochondrial protein transcript variant 2b for miRNA target validation
  $683.00
4 Weeks*
Specifications
Specifications
Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Target Symbol OGG1
Synonyms HMMH; HOGG1; MUTM; OGH1
ACCN NM_016826
Insert Size 545 bp
Sequence Data
Insert Sequence
>SC207238 3’UTR clone of NM_016826
The sequence shown below is from the reference sequence of NM_016826. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GTGATGCAAGCCAGCTTACTAGCACTTTGAGAATGAGTCTCCTGTTGAGCTGGTAGGATGTAAGCCTGG
AGCTAATGGCGATCATCTTTGCCACCACCTGGGGAGAGCCTGCTTGGGAATGAAATTAACACAAAGGAA
GTCCAACCTGAGAAATGGCCAAATATATTTCCTGATAACATTATGTGGCCCTCTGGATCCAGCCATGCC
TGAGGTCTACCCCTGGGCTTTTGGATTATGTGTACAGTTGGTTCATCCCTTTTTCTGCTAATTCGAGTC
ATGGCTAATTTAACACCCTTTAGAACCTTAAAGAACCATCAGCATCACCCGGGAACTTTTTTAGAAATG
CAAAATCTCTACTGCTTTGGATCCTGGGTCAAAAAAAAGAAAAAAAAAAGAAATGCAAAACTTTAGGCC
CTGCCCCAGATTTACTAAATCAATCTGCAGTTTAACAAAATCCTCAGGTGATTTGTATGCTCATTGAAC
TTTAAGAAGCAGTGTTTTAGAACAGGTTCTTAAAAAGGAACAAATAAACTCATTTAACTAAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI |
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_016826.3
Locus ID 4968
Summary This gene encodes the enzyme responsible for the excision of 8-oxoguanine, a mutagenic base byproduct which occurs as a result of exposure to reactive oxygen. The action of this enzyme includes lyase activity for chain cleavage. Alternative splicing of the C-terminal region of this gene classifies splice variants into two major groups, type 1 and type 2, depending on the last exon of the sequence. Type 1 alternative splice variants end with exon 7 and type 2 end with exon 8. All variants share the N-terminal region in common, which contains a mitochondrial targeting signal that is essential for mitochondrial localization. Many alternative splice variants for this gene have been described, but the full-length nature for every variant has not been determined. provided by RefSeq, Aug 2008
Reviews
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Documents
Resources

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.