Legumain (LGMN) (NM_001008530) Human 3' UTR Clone

SKU
SC207221
3' UTR clone of legumain (LGMN) transcript variant 2 for miRNA target validation
  $683.00
4 Weeks*
Specifications
Specifications
Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Target Symbol Legumain
Synonyms AEP; LGMN1; PRSC1
ACCN NM_001008530
Insert Size 540 bp
Sequence Data
Insert Sequence
>SC207221 3’UTR clone of NM_001008530
The sequence shown below is from the reference sequence of NM_001008530. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
ATGGACCACGTGTGCCTTGGTCACTACTGAAGAGCTGCCTCCTGGAAGCTTTTCCAAGTGTGAGCGCCC
CACCGACTGTGTGCTGATCAGAGACTGGAGAGGTGGAGTGAGAAGTCTCCGCTGCTCGGGCCCTCCTGG
GGAGCCCCCGCTCCAGGGCTCGCTCCAGGACCTTCTTCACAAGATGACTTGCTCGCTGTTACCTGCTTC
CCCAGTCTTTTCTGAAAAACTACAAATTAGGGTGGGAAAAGCTCTGTATTGAGAAGGGTCATATTTGCT
TTCTAGGAGGTTTGTTGTTTTGCCTGTTAGTTTTGAGGAGCAGGAAGCTCATGGGGGCTTCTGTAGCCC
CTCTCAAAAGGAGTCTTTATTCTGAGAATTTGAAGCTGAAACCTCTTTAAATCTTCAGAATGATTTTAT
TGAAGAGGGCCGCAAGCCCCAAATGGAAAACTGTTTTTAGAAAATATGATGATTTTTGATTGCTTTTGT
ATTTAATTCTGCAGGTGTTCAAGTCTTAAAAAATAAAGATTTATAACAGAACCCAAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI |
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001008530.3
Locus ID 5641
Summary This gene encodes a cysteine protease that has a strict specificity for hydrolysis of asparaginyl bonds. This enzyme may be involved in the processing of bacterial peptides and endogenous proteins for MHC class II presentation in the lysosomal/endosomal systems. Enzyme activation is triggered by acidic pH and appears to be autocatalytic. Protein expression occurs after monocytes differentiate into dendritic cells. A fully mature, active enzyme is produced following lipopolysaccharide expression in mature dendritic cells. Overexpression of this gene may be associated with the majority of solid tumor types. This gene has a pseudogene on chromosome 13. Several alternatively spliced transcript variants have been described, but the biological validity of only two has been determined. These two variants encode the same isoform. provided by RefSeq, Jul 2008
Reviews
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Documents
Resources

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.