OriGene Logo

ATP6V1E1 (NM_001039367) Human 3' UTR Clone

Be the first to review this product
SKU
SC207220
3' UTR clone of ATPase H+ transporting lysosomal 31kDa V1 subunit E1 (ATP6V1E1) transcript variant 3 for miRNA target validation
  $683.00
4 Weeks*
Size
Bulk Requests & Clone Modifications

Frequently Bought Together (2)

CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA) 5 x 200 ul
$160.00
PR300001 Firefly luciferase assay kit, 150 assays 1 kit
$215.00

Other products for "ATP6V1E1 or NM_001039367"

Specifications
Specifications
Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Target Symbol ATP6V1E1
Synonyms ARCL2C; ATP6E; ATP6E2; ATP6V1E; P31; Vma4
ACCN NM_001039367
Insert Size 568 bp
Sequence Data
Insert Sequence
>SC207220 3’UTR clone of NM_001039367
The sequence shown below is from the reference sequence of NM_001039367. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GCAAATGCCAACAGGAAGTTTTTGGACTAAGCCTTCAGGAGGTGGAGCTCGTCGTCAGCTCTCCTGCTG
TGATGTGGAAGCTTCTGATATTTGAAGAAACACGAATGTCTCTGTAGCTTCCTCTTCACTGCCCCAGTA
TTGCTCTGTATTTATCAGCGATGCCCCTCTGTCACTCATGCCTTGCCTAATTGTTCACAATGGTGGAAA
GCTTCATGTAATATGATCAGGACCCACCTCCAGTTCTTCTGAAAGTGTGACAGTGTCCAGCCGGTTCTG
CAGCACTAGGGGAGGGGGCAGATGGTGGTTGCATGGGCTTCCTGGGTCTCCACTCTCCGTCTGGCCTAA
AGGTGATGTATTTGGTGTTTGGCCCTGCAGTCCCCACTCTTGAGGCTTAAGGCGCATGTGGCACACCAC
TCCTTCCAGCAGTAGTCGCTTTACTGTTACCTGTTTAGGCCTAGAAGTTTTCCCTCATCTGTAAATGTG
ATTTAAAATCTAAGCCATGAATATGCTTTATTTATTAAAAGAGTTATGCGGATTTAATGTGATTTCTAG
TGTAAGGCACTACAAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI |
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001039367.1
Locus ID 529
Summary This gene encodes a component of vacuolar ATPase (V-ATPase), a multisubunit enzyme that mediates acidification of eukaryotic intracellular organelles. V-ATPase dependent organelle acidification is necessary for such intracellular processes as protein sorting, zymogen activation, receptor-mediated endocytosis, and synaptic vesicle proton gradient generation. V-ATPase is composed of a cytosolic V1 domain and a transmembrane V0 domain. The V1 domain consists of three A, three B, and two G subunits, as well as a C, D, E, F, and H subunit. The V1 domain contains the ATP catalytic site. This gene encodes alternate transcriptional splice variants, encoding different V1 domain E subunit isoforms. Pseudogenes for this gene have been found in the genome. provided by RefSeq, Jul 2008
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Documents
Resources

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.