OriGene Logo

Glycophorin C (GYPC) (NM_016815) Human 3' UTR Clone

Be the first to review this product
SKU
SC207153
3' UTR clone of glycophorin C (Gerbich blood group) (GYPC) transcript variant 2 for miRNA target validation
  $683.00
4 Weeks*
Size
Bulk Requests & Clone Modifications

Frequently Bought Together (2)

CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA) 5 x 200 ul
$160.00
PR300001 Firefly luciferase assay kit, 150 assays 1 kit
$215.00

Other products for "Glycophorin C or NM_016815"

Specifications
Specifications
Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Target Symbol Glycophorin C
Synonyms CD236; CD236R; GE; GE:GPC:GPD:GYPD; GPC; GPD; GYPD; PAS-2; PAS-2'
ACCN NM_016815
Insert Size 555 bp
Sequence Data
Insert Sequence
>SC207153 3’UTR clone of NM_016815
The sequence shown below is from the reference sequence of NM_016815. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GATAGCAGCAGAAAGGAGTACTTTATTTGAGGGACAACAGACTTCACTTCCCTGAATGCCTCCCCCATC
TCCATCAGGAAAAATACACCCCATCGCCCAGCACCCCTGCTGATACCACCAGACAGAGAGAGAGAGCAC
TTGATTCTTCCCGAGATAGCCACCTGGAAACACTAGGTGCCTGCCCAGGGAGGAACGGAGGAGGACTCG
CGCTACAAGAGGCCACTCCCAGGGACCCAGGGAGGCGATGGCCACCCCAGAGGCCACCTTTTGCTCCAC
GGAGGTGGGAGAAAATCTGGGCACATGGGGCCCCCTGGGCAGTGCAGGACAACATCAGCTCACTGGCAG
GAAAGTCCTTGTTGAGGGTGAGGGGGTGCTGGGGTACCCGGGGGCTGGGGAAGCAAGGAAATAAGTCAT
CTGTATGCTGACTGGGGATAATGGCATCAAATGTCAGTCCTTGACATTTGGGGGGAACAGCAGGTGCCA
GAGCTAAAAGGTACCTTTGTCTGCCATTGATCCAGCTCAGAACGATTGGAAATAAATTTGAAATGTAAC
CGA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI |
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_016815.4
Locus ID 2995
Summary Glycophorin C (GYPC) is an integral membrane glycoprotein. It is a minor species carried by human erythrocytes, but plays an important role in regulating the mechanical stability of red cells. A number of glycophorin C mutations have been described. The Gerbich and Yus phenotypes are due to deletion of exon 3 and 2, respectively. The Webb and Duch antigens, also known as glycophorin D, result from single point mutations of the glycophorin C gene. The glycophorin C protein has very little homology with glycophorins A and B. Alternate splicing results in multiple transcript variants. provided by RefSeq, Feb 2012
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Documents
Resources

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.