MAP3K4 (NM_005922) Human 3' UTR Clone

SKU
SC207147
3' UTR clone of mitogen-activated protein kinase kinase kinase 4 (MAP3K4) transcript variant 1 for miRNA target validation
  $683.00
4 Weeks*
Specifications
Specifications
Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Target Symbol MAP3K4
Synonyms MAPKKK4; MEKK 4; MEKK4; MTK1; PRO0412
ACCN NM_005922
Insert Size 540 bp
Sequence Data
Insert Sequence
>SC207147 3’UTR clone of NM_005922
The sequence shown below is from the reference sequence of NM_005922. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
TTTGTCAAGGTTTGCACAGATGAAGAATGAAGCCTAGTAGAATATGGACTTGGAAAATTCTCTTAATCA
CTACTGTATGTAATATTTACATAAAGACTGTGCTGAGAAGCAGTATAAGCCTTTTTAACCTTCCAAGAC
TGAAGACTGCACAGGTGACAAGCGTCACTTCTCCTGCTGCTCCTGTTTGTCTGATGTGGCAAAAGGCCC
TCTGGAGGGCTGGTGGCCACGAGGTTAAAGAAGCTGCATGTTAAGTGCCATTACTACTGTACACGGACC
ATCGCCTCTGTCTCCTCCGTGTCTCGCGCGACTGAGAACCGTGACATCAGCGTAGTGTTTTGACCTTTC
TAGGTTCAAAAGAAGTTGTAGTGTTATCAGGCGTCCCATACCTTGTTTTTAATCTCCTGTTTGTTGAGT
GCACTGACTGTGAAACCTTTACCTTTTTTGTTGTTGTTGGCAAGCTGCAGGTTTGTAATGCAAAAGGCT
GATTACTGAAATTTAAGAAAAAGGTTCTTTTTTCAATAAATGGTTTATTTTAGGAAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI |
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_005922.4
Locus ID 4216
Summary The central core of each mitogen-activated protein kinase (MAPK) pathway is a conserved cascade of 3 protein kinases: an activated MAPK kinase kinase (MAPKKK) phosphorylates and activates a specific MAPK kinase (MAPKK), which then activates a specific MAPK. While the ERK MAPKs are activated by mitogenic stimulation, the CSBP2 and JNK MAPKs are activated by environmental stresses such as osmotic shock, UV irradiation, wound stress, and inflammatory factors. This gene encodes a MAPKKK, the MEKK4 protein, also called MTK1. This protein contains a protein kinase catalytic domain at the C terminus. The N-terminal nonkinase domain may contain a regulatory domain. Expression of MEKK4 in mammalian cells activated the CSBP2 and JNK MAPK pathways, but not the ERK pathway. In vitro kinase studies indicated that recombinant MEKK4 can specifically phosphorylate and activate PRKMK6 and SERK1, MAPKKs that activate CSBP2 and JNK, respectively but cannot phosphorylate PRKMK1, an MAPKK that activates ERKs. MEKK4 is a major mediator of environmental stresses that activate the CSBP2 MAPK pathway, and a minor mediator of the JNK pathway. Several alternatively spliced transcripts encoding distinct isoforms have been described. provided by RefSeq, May 2014
Reviews
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Documents
Resources

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.