Kallikrein 6 (KLK6) (NM_001012964) Human 3' UTR Clone

SKU
SC207138
3' UTR clone of kallikrein-related peptidase 6 (KLK6) transcript variant B for miRNA target validation
  $683.00
4 Weeks*
Specifications
Specifications
Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Target Symbol Kallikrein 6
Synonyms Bssp; hK6; Klk7; PRSS9; PRSS18; SP59
ACCN NM_001012964
Insert Size 563 bp
Sequence Data
Insert Sequence
>SC207138 3’UTR clone of NM_001012964
The sequence shown below is from the reference sequence of NM_001012964. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
TGGATCCAAAAAACCATTCAGGCCAAGTGACCCTGACATGTGACATCTACCTCCCGACCTACCACCCCA
CTGGCTGGTTCCAGAACGTCTCTCACCTAGACCTTGCCTCCCCTCCTCTCCTGCCCAGCTCTGACCCTG
ATGCTTAATAAACGCAGCGACGTGAGGGTCCTGATTCTCCCTGGTTTTACCCCAGCTCCATCCTTGCAT
CACTGGGGAGGACGTGATGAGTGAGGACTTGGGTCCTCGGTCTTACCCCCACCACTAAGAGAATACAGG
AAAATCCCTTCTAGGCATCTCCTCTCCCCAACCCTTCCACACGTTTGATTTCTTCCTGCAGAGGCCCAG
CCACGTGTCTGGAATCCCAGCTCCGCTGCTTACTGTCGGTGTCCCCTTGGGATGTACCTTTCTTCACTG
CAGATTTCTCACCTGTAAGATGAAGATAAGGATGATACAGTCTCCATAAGGCAGTGGCTGTTGGAAAGA
TTTAAGGTTTCACACCTATGACATACATGGAATAGCACCTGGGCCACCATGCACTCAATAAAGAATGAA
TTTTATTATGA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI |
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001012964.3
Locus ID 5653
Summary This gene encodes a member of the kallikrein subfamily of the peptidase S1 family of serine proteases. Growing evidence suggests that many kallikreins are implicated in carcinogenesis and some have potential as novel cancer and other disease biomarkers. The encoded preproprotein is proteolytically processed to generate the mature protease. Expression of this protease is regulated by steroid hormones and may be elevated in multiple human cancers and in serum from psoriasis patients. The encoded protease may participate in the cleavage of amyloid precursor protein and alpha-synuclein, thus implicating this protease in Alzheimer's and Parkinson's disease, respectively. This gene is located in a gene cluster on chromosome 19. Alternative splicing results in multiple transcript variants, at least one of which encodes an isoform that is proteolytically processed. [provided by RefSeq, Feb 2016]
Reviews
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Documents
Resources

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.