OriGene Logo

VPS45A (VPS45) (NM_007259) Human 3' UTR Clone

Be the first to review this product
SKU
SC207134
3' UTR clone of vacuolar protein sorting 45 homolog (S. cerevisiae) (VPS45) for miRNA target validation
  $683.00
4 Weeks*
Size
Bulk Requests & Clone Modifications

Frequently Bought Together (2)

CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA) 5 x 200 ul
$160.00
PR300001 Firefly luciferase assay kit, 150 assays 1 kit
$215.00

Other products for "VPS45A or NM_007259"

Specifications
Specifications
Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Target Symbol VPS45A
Synonyms H1; H1VPS45; SCN5; VPS45A; VPS45B; VPS54A; VSP45; VSP45A
ACCN NM_007259
Insert Size 563 bp
Sequence Data
Insert Sequence
>SC207134 3’UTR clone of NM_007259
The sequence shown below is from the reference sequence of NM_007259. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GTCACATCAAGGTCAGCGAGCAGAAGATGAAACGGTGGTTGGGGGAAGGGCACAGCTTCCTCTCTTGTC
CCCACTACAGGTTTTCCCTACTAAACAAAGGTGTTGGAGAGCAGCTTTGGGTTCTGTGCTGGTTGTTAG
AACTCATCTCCAGGTAGCCCACGGATACGTGGTTGGCACAGACACAAGACTCCCAGAGTTGTCCTAACA
ATAAGTCTGAGCCCATCTCAACCCACTTTTCTCCGGTAGTCTTTATGTATCTGTTAGCACAATCACTTC
AGTTACTGATGAATTTTGTTGGGATCTGACTTGGGGAAAGGGTTATCAGAGCCTAGAGGGGCTTAAAAA
GTAATCATTTGATGTACATACCACACTCCTTGGCTTCCTTTCTCTTCCCTTAACCCTTTCTGCTTTTCA
TTAACCACATTCCTGCACAACTCATTTCTGAAAACCTACCATGTTTCTTTACAGAGCCATCCAAAAATT
TTTTGTCCCTACATAGCAATTTTCTGTGGCACTGAGAAACCATGTATGACCACAATAAAAATCCATTTT
GTGAAAGGATA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI |
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_007259.5
Locus ID 11311
Summary Vesicle mediated protein sorting plays an important role in segregation of intracellular molecules into distinct organelles. Genetic studies in yeast have identified more than 40 vacuolar protein sorting (VPS) genes involved in vesicle transport to vacuoles. This gene is a member of the Sec1 domain family, and shows a high degree of sequence similarity to mouse, rat and yeast Vps45. The exact function of this gene is not known, but its high expression in peripheral blood mononuclear cells suggests a role in trafficking proteins, including inflammatory mediators. Multiple alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jul 2013]
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Documents
Resources

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.