OriGene Logo

SPTLC1 (NM_178324) Human 3' UTR Clone

Be the first to review this product
SKU
SC207104
3' UTR clone of serine palmitoyltransferase long chain base subunit 1 (SPTLC1) transcript variant 2 for miRNA target validation
  $683.00
4 Weeks*
Size
Bulk Requests & Clone Modifications

Frequently Bought Together (2)

CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA) 5 x 200 ul
$160.00
PR300001 Firefly luciferase assay kit, 150 assays 1 kit
$215.00

Other products for "SPTLC1 or NM_178324"

Specifications
Specifications
Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Target Symbol SPTLC1
Synonyms HSAN1; HSN1; LBC1; LCB1; SPT1; SPTI
ACCN NM_178324
Insert Size 531 bp
Sequence Data
Insert Sequence
>SC207104 3’UTR clone of NM_178324
The sequence shown below is from the reference sequence of NM_178324. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CCCAGAGGATTTTATGGCACATTTGAATGAAGATGAAGGATCATTGATTTCCTTGTGTATGGATAATCC
GGGAACAGGCCAACTAAATATTTGATGAATGTATGATTTCAAATACAGTGAATTCCCTGGGAGTCATCA
AAGAAGACCGGCATTTTATGGTTGTTTTTATTAAGTGTATATTCTTTGCTCCTGAAAATGTTATTAAAT
AATTGTTTAGGCCGGGCATGGTGGCTCATGCCTGTAATCCCAGCACTTTCAAAGGCTGAGGCAGGCAGA
TCACCTGAGGTCAGGAGTTCAAAACCAGCCTGGCCAACATGCTGAAACCTCGTCTCTACTAAAAATACA
AAAATTAGCTGGGCGTGGTGGTGGATACCTGTAATCCCAGCTACGTGGGAGGCTGAGGTGGGAGAATTG
CTTCAACCTGGGAGGCAGAGGTTGCAGTGAGCCGAGATCATGCCACTGCACTCCAGCCTGGGCAACAGA
GCAAGACTGTCTCAAAAATAAATAAATAAATAAAATTGTTTAAATGAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI |
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_178324.3
Locus ID 10558
Summary This gene encodes a member of the class-II pyridoxal-phosphate-dependent aminotransferase family. The encoded protein is the long chain base subunit 1 of serine palmitoyltransferase. Serine palmitoyltransferase converts L-serine and palmitoyl-CoA to 3-oxosphinganine with pyridoxal 5'-phosphate and is the key enzyme in sphingolipid biosynthesis. Mutations in this gene were identified in patients with hereditary sensory neuropathy type 1. Alternatively spliced variants encoding different isoforms have been identified. Pseudogenes of this gene have been defined on chromosomes 1, 6, 10, and 13. [provided by RefSeq, Jul 2013]
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Documents
Resources

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.