OriGene Logo

IFT140 (NM_014714) Human 3' UTR Clone

Be the first to review this product
SKU
SC207073
3' UTR clone of intraflagellar transport 140 homolog (Chlamydomonas) (IFT140) for miRNA target validation
  $683.00
4 Weeks*
Size
Bulk Requests & Clone Modifications

Frequently Bought Together (2)

CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA) 5 x 200 ul
$160.00
PR300001 Firefly luciferase assay kit, 150 assays 1 kit
$215.00

Other products for "IFT140 or NM_014714"

Specifications
Specifications
Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Target Symbol IFT140
Synonyms c305C8.4; c380F5.1; gs114; MZSDS; RP80; SRTD9; WDTC2
ACCN NM_014714
Insert Size 547 bp
Sequence Data
Insert Sequence
>SC207073 3’UTR clone of NM_014714
The sequence shown below is from the reference sequence of NM_014714. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GTGGTGGAAGAGGCAGATGACGACCCCTGAGGGGCCTGGGCCCCAGGACCAGCGTGCTGCTGCAGAAAG
GCATCTTCTGGAATTTTTTTGTCAGCTGTGGCAAAGCCAGCATTTTTGCTGGGAAAAAACATGTCTGTG
TTGGAATACGCGACAGAGCTGGGCGAGAACGCAGCGGCCCGGGCCGGCGGAGGGTGTGACCCGTCTGCA
CCTTGCTCTGTCCCACCTGCCTCTGGGTGCCCGGCAGCTCCACTAGATTTTTGGATTCATTCCTTTGAA
GGGAGTCGGGTTCACCCTTCCATCGTATTCTCCCAACTACACATTGTAAAGCCTGAGAAACTTCTAGAA
CCTCAGGAAGCTGCAGCTGGAGGGCTGGGGCACCTGCCCCCCTGCTCCCCACACATCATATCCTCCCCA
TACTCCTGCAGGGCCCACGGCTCCTGAGCAACAGCTGGGACACCCGGGCCTTGGCGGCTGCACCCCCTG
CTAGGCTCTGCCCACCGGCCACCAACACTCCTGTAATTCCAATAAAGCAGTTTATTTTCTGAGA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI |
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_014714.4
Locus ID 9742
Summary This gene encodes one of the subunits of the intraflagellar transport (IFT) complex A. Intraflagellar transport is involved in the genesis, resorption and signaling of primary cilia. The primary cilium is a microtubule-based sensory organelle at the surface of most quiescent mammalian cells, that receives signals from its environment, such as the flow of fluid, light or odors, and transduces those signals to the nucleus. Loss of the corresponding protein in mouse results in renal cystic disease. provided by RefSeq, Jun 2012
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Documents
Resources

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.