OriGene Logo

BMAL1 (ARNTL) (NM_001030272) Human 3' UTR Clone

Be the first to review this product
SKU
SC207070
3' UTR clone of aryl hydrocarbon receptor nuclear translocator-like (ARNTL) transcript variant 2 for miRNA target validation
  $683.00
4 Weeks*
Size
Bulk Requests & Clone Modifications

Frequently Bought Together (2)

CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA) 5 x 200 ul
$160.00
PR300001 Firefly luciferase assay kit, 150 assays 1 kit
$215.00

Other products for "BMAL1 or NM_001030272"

Specifications
Specifications
Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Target Symbol BMAL1
Synonyms bHLHe5; BMAL1; BMAL1c; JAP3; MOP3; PASD3; TIC
ACCN NM_001030272
Insert Size 540 bp
Sequence Data
Insert Sequence
>SC207070 3’UTR clone of NM_001030272
The sequence shown below is from the reference sequence of NM_001030272. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GACTTTAGTGACTTGCCATGGCCGCTGTAAACACTACATGTTGCTTTGGCAACAGCTATAGTATCAAAG
TGCATTACTGGTGGAGTTTTACAGTCTGTGAAGCTTACTGGATAAGGAGAGAATAGCTTTTATGTACTG
ACTTCATAAAAGCCATCTCAGAGCCATTGATACAAGTCAATCTTACTATATGTAACTTCAGACAAAGTG
GAACTAAGCCTGCTCCAGTGTTTCCTCATCATTGATTATTGGGCTAGCTGTGGATAGCTTGCATTAATT
GTATATTTTGGATTCTGTTTGTGTTGAATTTTTTAATCATTGTGCACAGAAGCATCATTGGTAGCTTTT
ATATGCAAATGGTCATTTCAGATGTATGGTGTTTTTACACTACAAAGAAGTCCCCCATGTGGATATTTC
TTATACTAATTGTATCATAAAGCCGTTTATTCTTCCTTGTAAGAATCCTTTACTATAAATATGGGTTAA
AGTATAATGTACTAGACAGTTAAATATTTTTAATAAATGTTTCCCTTGTTCTATAAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI |
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001030272.3
Locus ID 406
Summary The protein encoded by this gene is a basic helix-loop-helix protein that forms a heterodimer with CLOCK. This heterodimer binds E-box enhancer elements upstream of Period (PER1, PER2, PER3) and Cryptochrome (CRY1, CRY2) genes and activates transcription of these genes. PER and CRY proteins heterodimerize and repress their own transcription by interacting in a feedback loop with CLOCK/ARNTL complexes. Defects in this gene have been linked to infertility, problems with gluconeogenesis and lipogenesis, and altered sleep patterns. Several transcript variants encoding different isoforms have been found for this gene. provided by RefSeq, Jul 2014
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Documents
Resources

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.