RAD17 (NM_133339) Human 3' UTR Clone

SKU
SC207054
3' UTR clone of RAD17 homolog (S. pombe) (RAD17) transcript variant 2 for miRNA target validation
  $683.00
4 Weeks*
Specifications
Specifications
Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Target Symbol RAD17
Synonyms CCYC; HRAD17; R24L; RAD17SP; RAD24
ACCN NM_133339
Insert Size 556 bp
Sequence Data
Insert Sequence
>SC207054 3’UTR clone of NM_133339
The sequence shown below is from the reference sequence of NM_133339. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
ATAGAAGACTACGAGAGTGATGGGACATAGAAGCCAGCCTGCTAATCAGATTGCTACTTCACAGCTTCA
TTTTTGTTTCATTCAGTGGTACTTCAGCAGAGTTAATATGCTTTTCTGATGAATTACACAACAGTTTGT
TAATTCTTCATTCTTGTAGTATTTCATCACAAGAAACCTACTCTTCTGTCATCTTGAAGTAAATAGAAG
ATCAAGCCTTCAAATCTCTTAATTTTTTCGGTATTTATTAAATCTGTGAGTGGTTTAAGGAGCGGTCAG
TGTGTATAAAGTGTGTTTGAACATTATGCCAAATATCAAGATGTGAAGGACTAATTCAGGATGCAAAAA
CGTTATTGGGGGGTTGTAAATATCAACTATTCAACAGTTTAGGATGCAATTACGAGTGTAAACTGTGTG
CCTTATTTACACTTTATTGTCTCCCGCTTCTCAGATAGTTTTGATGTGTTGTACAGTGGAATATCTTAG
ATACTTTTTGGAAAGTATTTACATAAGTTATATCACAATTAAAATGTTGAATTTAAAAAAAAAAAAAAA
AAAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI |
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_133339.2
Locus ID 5884
Summary The protein encoded by this gene is highly similar to the gene product of Schizosaccharomyces pombe rad17, a cell cycle checkpoint gene required for cell cycle arrest and DNA damage repair in response to DNA damage. This protein shares strong similarity with DNA replication factor C (RFC), and can form a complex with RFCs. This protein binds to chromatin prior to DNA damage and is phosphorylated by the checkpoint kinase ATR following damage. This protein recruits the RAD1-RAD9-HUS1 checkpoint protein complex onto chromatin after DNA damage, which may be required for its phosphorylation. The phosphorylation of this protein is required for the DNA-damage-induced cell cycle G2 arrest, and is thought to be a critical early event during checkpoint signaling in DNA-damaged cells. Multiple alternatively spliced transcript variants of this gene, which encode four distinct protein isoforms, have been reported. Two pseudogenes, located on chromosomes 7 and 13, have been identified. [provided by RefSeq, Jul 2013]
Reviews
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Documents
Resources

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.