PACE4 (PCSK6) (NM_138322) Human 3' UTR Clone

SKU
SC207043
3' UTR clone of proprotein convertase subtilisin/kexin type 6 (PCSK6) transcript variant 3 for miRNA target validation
  $683.00
4 Weeks*
Specifications
Specifications
Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Target Symbol PACE4
Synonyms PACE4; SPC4
ACCN NM_138322
Insert Size 578 bp
Sequence Data
Insert Sequence
>SC207043 3’UTR clone of NM_138322
The sequence shown below is from the reference sequence of NM_138322. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
TGGACCATTGGGTGGCCCTGGAATGTGTAGGAAGGGGTGTCATGAATTCCTTAAAAGGACTCTCCAAAT
AGCATTAGTTGTTATTATTAATTGTGTGTCACAAGAATTTAAAACGCATGTGCAGCTATTTAAGAAAAG
TATCCCGGAAGCTCACAGTGACATTACGGAAGAACCCTCAGGTCACAAGAGTCTGGGGTCTCCTATACT
CTATAACTTTGGCCACACCGAGACACCACCTATACCAATATTTACTCATAGTTCTCTTTAAGCCAGGAG
CAATGACGTGTGCCTATAGTCGCAGCTACTAGGGAAGTTGAGGCAGGAGGATTGCTTGAGCCCAGGAAT
TTGAGTCTAGCCTGGACAACACAGCAGGACTCCATCTCTTAAAAAAAAAATTACTTCCCCCACTACTTT
TTTTTGACATAAAAAAATGTATTTTAAAAGGAAACTGTACTACATCTAGTTAATCATAGGTTTGATATG
TAGTTACGTATTTTTTCTAATGTGCATTAAAACAAATCCATAATTATTAAAATAAATGTTGTTTGTGTG
CCACCTGAGGGCAGCTTGCATCCTTA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI |
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_138322.4
Locus ID 5046
Summary This gene encodes a member of the subtilisin-like proprotein convertase family, which includes proteases that process protein and peptide precursors trafficking through regulated or constitutive branches of the secretory pathway. The encoded protein undergoes an initial autocatalytic processing event in the ER to generate a heterodimer which exits the ER and sorts to the trans-Golgi network where a second autocatalytic event takes place and the catalytic activity is acquired. The encoded protease is constitutively secreted into the extracellular matrix and expressed in many tissues, including neuroendocrine, liver, gut, and brain. This gene encodes one of the seven basic amino acid-specific members which cleave their substrates at single or paired basic residues. Some of its substrates include transforming growth factor beta related proteins, proalbumin, and von Willebrand factor. This gene is thought to play a role in tumor progression and left-right patterning. Alternatively spliced transcript variants encoding different isoforms have been identified. provided by RefSeq, Feb 2014
Reviews
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Documents
Resources

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.