Metabotropic Glutamate Receptor 3 (GRM3) (NM_000840) Human 3' UTR Clone

SKU
SC207008
3' UTR clone of glutamate receptor metabotropic 3 (GRM3) for miRNA target validation
  $683.00
4 Weeks*
Specifications
Specifications
Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Target Symbol Metabotropic Glutamate Receptor 3
Synonyms GLUR3; GPRC1C; mGlu3; MGLUR3
ACCN NM_000840
Insert Size 554 bp
Sequence Data
Insert Sequence
>SC207008 3’UTR clone of NM_000840
The sequence shown below is from the reference sequence of NM_000840. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GTCCTCGACTCCACCACCTCATCTCTGTGATTGTGAATTGCAGTTCAGTTCTTGTGTTTTTAGACTGTT
AGACAAAAGTGCTCACGTGCAGCTCCAGAATATGGAAACAGAGCAAAAGAACAACCCTAGTACCTTTTT
TTAGAAACAGTACGATAAATTATTTTTGAGGACTGTATATAGTGATGTGCTAGAACTTTCTAGGCTGAG
TCTAGTGCCCCTATTATTAACAATTCCCCCAGAACATGGAAATAACCATTGTTTACAGAGCTGAGCATT
GGTGACAGGGTCTGACATGGTCAGTCTACTAAAAAACAAAAAAAAAAAACAAAAAAAAAAAAACAAAAG
AAAAAAATAAAAATACGGTGGCAATATTATGTAACCTTTTTTCCTATGAAGTTTTTTGTAGGTCCTTGT
TGTAACTAATTTAGGATGAGTTTCTATGTTGTATATTAAAGTTACATTATGTGTAACAGATTGATTTTC
TCAGCACAAAATAAAAAGCATCTGTATTAATGTAAAGATACTGAGAATAAAACCTTCAAGGTTTTCCAG
CA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI |
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_000840.3
Locus ID 2913
Summary L-glutamate is the major excitatory neurotransmitter in the central nervous system and activates both ionotropic and metabotropic glutamate receptors. Glutamatergic neurotransmission is involved in most aspects of normal brain function and can be perturbed in many neuropathologic conditions. The metabotropic glutamate receptors are a family of G protein-coupled receptors, that have been divided into 3 groups on the basis of sequence homology, putative signal transduction mechanisms, and pharmacologic properties. Group I includes GRM1 and GRM5 and these receptors have been shown to activate phospholipase C. Group II includes GRM2 and GRM3 while Group III includes GRM4, GRM6, GRM7 and GRM8. Group II and III receptors are linked to the inhibition of the cyclic AMP cascade but differ in their agonist selectivities. [provided by RefSeq, Jul 2008]
Reviews
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Documents
Resources

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.