OriGene Logo

RPL34 (NM_000995) Human 3' UTR Clone

Be the first to review this product
SKU
SC206994
3' UTR clone of ribosomal protein L34 (RPL34) transcript variant 1 for miRNA target validation
  $683.00
4 Weeks*
Size
Bulk Requests & Clone Modifications

Frequently Bought Together (2)

CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA) 5 x 200 ul
$160.00
PR300001 Firefly luciferase assay kit, 150 assays 1 kit
$215.00

Other products for "RPL34 or NM_000995"

Specifications
Specifications
Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Target Symbol RPL34
Synonyms L34
ACCN NM_000995
Insert Size 535 bp
Sequence Data
Insert Sequence
>SC206994 3’UTR clone of NM_000995
The sequence shown below is from the reference sequence of NM_000995. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GCACAAGCACAGAGTCAGAAAGCTAAATAAAAAAATGAAACTTTTTTGAGTAATAAAAATGAAAAGACG
CTGTCCAATAGAAAAAGTTGGTGTGCTGGAGCTACCTCACCTCAGCTTGAGAGAGCCAGTTGTGTGCAT
CTCTTTCCAGTTTTGCATCCAGTGACGTCTGCTTGGCATCTTGAGATTGTTATGGTGAGAGTATTTACA
CCTCAGCAAATGCTGCAAAATCCTGTTTTCCCCCAGAGAGCTGGAGGTTAAATACTACCAGCACATCCC
TAGATACTACTCAAGTTACAGTATATGATCACTAATATAGTATGCTCTTGGTACCAGGAGCTCTGATAT
ATATCTGGTACATGTTTGATAATGACTTGATTGTTATTATAAGTACTTATTAATACTTCGATTCTGTAA
AGAGTTTAGGGTTTGATTTTATAAAATCCAAAATGAGCCTTTTATTGAATCCAGTTCTCTATGTGACCA
GTTCTCTGTATGAATGGAAGGGAAAAGAATTAAAAATCTTGCAAAGGGGAAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI |
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_000995.5
Locus ID 6164
Summary Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 60S subunit. The protein belongs to the L34E family of ribosomal proteins. It is located in the cytoplasm. This gene originally was thought to be located at 17q21, but it has been mapped to 4q. Overexpression of this gene has been observed in some cancer cells. Alternative splicing results in multiple transcript variants, all encoding the same isoform. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. [provided by RefSeq, Feb 2016]
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Documents
Resources

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.