OriGene Logo

TAF7 (NM_005642) Human 3' UTR Clone

Be the first to review this product
SKU
SC206992
3' UTR clone of TAF7 RNA polymerase II TATA box binding protein (TBP)-associated factor 55kDa (TAF7) for miRNA target validation
  $683.00
4 Weeks*
Size
Bulk Requests & Clone Modifications

Frequently Bought Together (2)

CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA) 5 x 200 ul
$160.00
PR300001 Firefly luciferase assay kit, 150 assays 1 kit
$215.00

Other products for "TAF7 or NM_005642"

Specifications
Specifications
Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Target Symbol TAF7
Synonyms TAF2F; TAFII55
ACCN NM_005642
Insert Size 535 bp
Sequence Data
Insert Sequence
>SC206992 3’UTR clone of NM_005642
The sequence shown below is from the reference sequence of NM_005642. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GAGGAGCTAGAATCACTCCTAGAGAAGTAAAAAGAACTGATATTTAATTTCAGTCTTCAGACTGGTCAG
CATTAGAAAATTCTTGGCTTTATTGTACTGGGTATTAAGACCTTGCTCTTCCTAGTCCTTTTAATGCTG
TGTGTTCTGTTAAGTTCTTTCATTTGTTTGTAATTTTGTTTTTCAGCAAATTTATATTGTTTTGCTAGG
TGTTCATCCTATAAGAAGCAGGATTGTATAGGCAGAAAAATGATTGTAGGAAAGTTGCAGGATTAGCGG
AATGTATGGTTCAACCTTAATTATAGCTTCATTGCAGGACTTTACTGTTTCTCCATTTTCTAGAAGCTG
CTGTTGCTGCTTTGTGATGACGTGAGATCAATAAGAAGAACCTAGTCTAGAGACAATGATGCTAGTTTG
CATATGTTTTCCTATGCAATAATTGTTTTCCCAGTTATTCAAAGCAGCTTTCTATATGTAGAGATGCAA
ATTATTAAGTTGTTTCCAATACAATAAATAAAAGCATCTGTTTTTCACTTTA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI |
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_005642.3
Locus ID 6879
Summary The intronless gene for this transcription coactivator is located between the protocadherin beta and gamma gene clusters on chromosome 5. The protein encoded by this gene is a component of the TFIID protein complex, a complex which binds to the TATA box in class II promoters and recruits RNA polymerase II and other factors. This particular subunit interacts with the largest TFIID subunit, as well as multiple transcription activators. The protein is required for transcription by promoters targeted by RNA polymerase II. [provided by RefSeq, Jul 2008]
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Documents
Resources

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.