Cytokeratin 4 (KRT4) (NM_002272) Human 3' UTR Clone

SKU
SC206987
3' UTR clone of keratin 4 (KRT4) for miRNA target validation
  $683.00
4 Weeks*
Specifications
Specifications
Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Target Symbol Cytokeratin 4
Synonyms CK-4; CK4; CYK4; K4; WSN1
ACCN NM_002272
Insert Size 550 bp
Sequence Data
Insert Sequence
>SC206987 3’UTR clone of NM_002272
The sequence shown below is from the reference sequence of NM_002272. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
TCTACCACCACCCTGAACAAGAGACGATAGAGGAGACGAGGTCCCTGCAGCTCACTGTGTCCAGCTGGG
CCCAGCACTGGTGTCTCTGTGCTTCCTTCACTTCACCTCCATCCTCTGTCTCTGGGGCTCATCTTACTA
GTATCCCCTCCACTATCCCATGGGCTCTCTCTGCCCCAGGATGATCTTCTGTGCTGGGACAGGGACTCT
GCCTCTTGGAGTTTGGTAGCTACTTCTTGATTTGGGCCTGGTGACCCACCTGGAATGGGAAGGATGTCA
GCTGACCTCTCACCTCCCATGGACAGAGAAGAAAATGACCAGGAGTGTCATCTCCAGAATTATTGGGGT
CACATATGTCCCTTCCCAGTCCAATGCCATCTCCCACTAGATCCTGTATTATCCATCTACATCAGAACC
AAACTACTTCTCCAACACCCGGCAGCACTTGGCCCTGCAAGCTTAGGATGAGAACCACTTAGTGTCCCA
TTCTACTCCTCTCATTCCCTCTTATCCATCTGCAGGTGAATCTTCAATAAAATGCTTTTGTCATTCA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI |
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_002272.4
Locus ID 3851
Summary The protein encoded by this gene is a member of the keratin gene family. The type II cytokeratins consist of basic or neutral proteins which are arranged in pairs of heterotypic keratin chains coexpressed during differentiation of simple and stratified epithelial tissues. This type II cytokeratin is specifically expressed in differentiated layers of the mucosal and esophageal epithelia with family member KRT13. Mutations in these genes have been associated with White Sponge Nevus, characterized by oral, esophageal, and anal leukoplakia. The type II cytokeratins are clustered in a region of chromosome 12q12-q13. provided by RefSeq, Jul 2008
Reviews
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Documents
Resources

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.