OriGene Logo

CD239 (BCAM) (NM_005581) Human 3' UTR Clone

Be the first to review this product
SKU
SC206960
3' UTR clone of basal cell adhesion molecule (Lutheran blood group) (BCAM) transcript variant 1 for miRNA target validation
  $683.00
4 Weeks*
Size
Bulk Requests & Clone Modifications

Frequently Bought Together (2)

CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA) 5 x 200 ul
$160.00
PR300001 Firefly luciferase assay kit, 150 assays 1 kit
$215.00

Other products for "CD239 or NM_005581"

Specifications
Specifications
Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Target Symbol CD239
Synonyms AU; CD239; LU; MSK19
ACCN NM_005581
Insert Size 530 bp
Sequence Data
Insert Sequence
>SC206960 3’UTR clone of NM_005581
The sequence shown below is from the reference sequence of NM_005581. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GGCAGCGGGGGCTTCGGAGACGAGTGCTGAGCCAAGAACCTCCTAGAGGCTGTCCCTGGACCTGGAGCT
GCAGGCATCAGAGAACCAGCCCTGCTCACGCCATGCCCGCCCCCGCCTTCCCTCTTCCCTCTTCCCTCT
CCCTGCCCAGCCCTCCCTTCCTTCCTCTGCCGGCAAGGCAGGGACCCACAGTGGCTGCCTGCCTCCGGG
AGGGAAGGAGAGGGAGGGTGGGTGGGTGGGAGGGGGCCTTCCTCCAGGGAATGTGACTCTCCCAGGCCC
CAGAATAGCTCCTGGACCCAAGCCCAAGGCCCAGCCTGGGACAAGGCTCCGAGGGTCGGCTGGCCGGAG
CTATTTTTACCTCCCGCCTCCCCTGCTGGTCCCCCCACCTGACGTCTTGCTGCAGAGTCTGACACTGGA
TTCCCCCCCCTCACCCCGCCCCTGGTCCCACTCCTGCCCCCGCCCTACCTCCGCCCCACCCCATCATCT
GTGGACACTGGAGTCTGGAATAAATGCTGTTTGTCACATCAACACCA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI |
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_005581.5
Locus ID 4059
Summary This gene encodes Lutheran blood group glycoprotein, a member of the immunoglobulin superfamily and a receptor for the extracellular matrix protein, laminin. The protein contains five extracellular immunoglobulin domains, a single transmembrane domain, and a short C-terminal cytoplasmic tail. This protein may play a role in epithelial cell cancer and in vaso-occlusion of red blood cells in sickle cell disease. Polymorphisms in this gene define some of the antigens in the Lutheran system and also the Auberger system. Inactivating variants of this gene result in the recessive Lutheran null phenotype, Lu(a-b-), of the Lutheran blood group. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2012]
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Documents
Resources

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.