OriGene Logo

MPP1 (NM_002436) Human 3' UTR Clone

Be the first to review this product
SKU
SC206902
3' UTR clone of membrane protein palmitoylated 1 55kDa (MPP1) for miRNA target validation
  $683.00
4 Weeks*
Size
Bulk Requests & Clone Modifications

Frequently Bought Together (2)

CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA) 5 x 200 ul
$160.00
PR300001 Firefly luciferase assay kit, 150 assays 1 kit
$215.00

Other products for "MPP1 or NM_002436"

Specifications
Specifications
Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Target Symbol MPP1
Synonyms AAG12; DXS552E; EMP55; MRG1; PEMP
ACCN NM_002436
Insert Size 523 bp
Sequence Data
Insert Sequence
>SC206902 3’UTR clone of NM_002436
The sequence shown below is from the reference sequence of NM_002436. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CAGTGGGTGCCTGTCTCCTGGGTTTACTAAGCTTGTAGAATGGGGGAACCCACTGTATGCCCCTCTCCA
GCATTTGGAATTCCACCCGCCTTGCTTTAAGACAAACAGGGCTGCTCCAACTAGTTTTGTGTCAGCTTC
CAGCTCTCTGCAGCTATCCTAATTCAGCCAGTAAGGTTCAGTCTTCTTGCTCAGGCTCCTGAAGGGTTG
ATTCTCCTGATAGATGGGGCCCCACTGATCTGGATTTGAAAAGGATTTCTAGAAATTGGGGGTAAGAAG
TACTACCAAAATGTAACTGCTAATCAAGGGTGATGCACAGCAAAAGCAATGGACCCCATCCCTCTAAAG
CCTGCCCTCCTTTGCCTTCAACTGTATATGCTGGGTATTTCATTTGTCTTTTTATTTTGGAGAAAGCGT
TTTTAACTGCAACTTTCTATAATGCCAAAATGACACATCTGTGCAATAGAATGATGTCTGCTCTAGGGA
AACCTTCAAAAGCAATAAAAATGCTGTGTTGAAATGCCAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI |
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_002436.4
Locus ID 4354
Summary This gene encodes the prototype of the membrane-associated guanylate kinase (MAGUK) family proteins. MAGUKs interact with the cytoskeleton and regulate cell proliferation, signaling pathways, and intercellular junctions. The encoded protein is an extensively palmitoylated membrane phosphoprotein containing a PDZ domain, a Src homology 3 (SH3) motif, and a guanylate kinase domain. This gene product interacts with various cytoskeletal proteins and cell junctional proteins in different tissue and cell types, and may be involved in the regulation of cell shape, hair cell development, neural patterning of the retina, and apico-basal polarity and tumor suppression pathways in non-erythroid cells. Multiple transcript variants encoding different isoforms have been found for this gene. provided by RefSeq, Oct 2009
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Documents
Resources

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.