KIR2DL2 (NM_014219) Human 3' UTR Clone

SKU
SC206887
3' UTR clone of killer cell immunoglobulin-like receptor two domains long cytoplasmic tail 2 (KIR2DL2) for miRNA target validation
  $683.00
4 Weeks*
Specifications
Specifications
Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Target Symbol KIR2DL2
Synonyms CD158b; CD158B1; NKAT-6; NKAT6; p58.2
ACCN NM_014219
Insert Size 541 bp
Sequence Data
Insert Sequence
>SC206887 3’UTR clone of NM_014219
The sequence shown below is from the reference sequence of NM_014219. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
TCCAGATCCAAAGTTGTCTCCTGCCCATGAGCACCACAGTCAGGCCTTGAGGGCGTCTTCTAGGGAGAC
AACAGCCCTGTCTCAAAACCGGGTTGCCAGCTCCCATGTACCAGCAGCTGGAATCTGAAGGCATGAGTC
TGCATCTTAGGGCATCGCTCTTCCTCACACCACAAATCTGAATGTGCCTCTCACTTGCTTACAAATGTC
TAAGGTCCCCACTGCCTGCTGGAGAAAAAACACACTCCTTTGCTTAGCCCACAGTTCTCCATTTCACTT
GACCCCTGCCCACCTCTCCAACCTAACTGGCTTACTTCCTAGTCTACTTGAGGCTGCAATCACACTGAG
GAACTCACAATTCCAAACATACAAGAGGCTCCCTCTTAACGCAGCACTTAGACACGTGTTGTTCCACCT
TCCCTCATGCTGTTCCACCTCCCCTCAGACTAGCTTTCAGTCTTCTGTCAGCAGTAAAACTTATATATT
TTTTAAAATAACTTCAATGTAGTTTTCCATCCTTCAAATAAACATGTCTGCCCCCATG
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI |
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_014219.2
Locus ID 3803
Summary Killer cell immunoglobulin-like receptors (KIRs) are transmembrane glycoproteins expressed by natural killer cells and subsets of T cells. The KIR genes are polymorphic and highly homologous and they are found in a cluster on chromosome 19q13.4 within the 1 Mb leukocyte receptor complex (LRC). The gene content of the KIR gene cluster varies among haplotypes, although several "framework" genes are found in all haplotypes (KIR3DL3, KIR3DP1, KIR3DL4, KIR3DL2). The KIR proteins are classified by the number of extracellular immunoglobulin domains (2D or 3D) and by whether they have a long (L) or short (S) cytoplasmic domain. KIR proteins with the long cytoplasmic domain transduce inhibitory signals upon ligand binding via an immune tyrosine-based inhibitory motif (ITIM), while KIR proteins with the short cytoplasmic domain lack the ITIM motif and instead associate with the TYRO protein tyrosine kinase binding protein to transduce activating signals. The ligands for several KIR proteins are subsets of HLA class I molecules; thus, KIR proteins are thought to play an important role in regulation of the immune response. provided by RefSeq, Jul 2008
Reviews
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Documents
Resources

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.