BIN1 (NM_139347) Human 3' UTR Clone

SKU
SC206883
3' UTR clone of bridging integrator 1 (BIN1) transcript variant 5 for miRNA target validation
  $683.00
4 Weeks*
Specifications
Specifications
Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Target Symbol BIN1
Synonyms AMPH2; AMPHL; CNM2; SH3P9
ACCN NM_139347
Insert Size 524 bp
Sequence Data
Insert Sequence
>SC206883 3’UTR clone of NM_139347
The sequence shown below is from the reference sequence of NM_139347. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CCCGAGAACTTCACTGAGAGGGTCCCATGACGGCGGGGCCCAGGCAGCCTCCGGGCGTGTGAAGAACAC
CTCCTCCCGAAAAATGTGTGGTTCTTTTTTTTGTTTTGTTTTCGTTTTTCATCTTTTGAAGAGCAAAGG
GAAATCAAGAGGAGACCCCCAGGCAGAGGGGCGTTCTCCCAAAGATTAGGTCGTTTTCCAAAGAGCCGC
GTCCCGGCAAGTCCGGCGGAATTCACCAGTGTTCCTGAAGCTGCTGTGTCCTCTAGTTGAGTTTCTGGC
GCCCCTGCCTGTGCCCGCATGTGTGCCTGGCCGCAGGGCGGGGCTGGGGGCTGCCGAGCCACCATGCTT
GCCTGAAGCTTCGGCCGCGCCACCCGGGCAAGGGTCCTCTTTTCCTGGCAGCTGCTGTGGGTGGGGCCC
AGACACCAGCCTAGCCTGGCTCTGCCCCGCAGACGGTCTGTGTGCTGTTTGAAAATAAATCTTAGTGTT
CAAAACAAAATGAAACAAAAAAAAAATGATAAAAACTCTCA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI |
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_139347.3
Locus ID 274
Summary This gene encodes several isoforms of a nucleocytoplasmic adaptor protein, one of which was initially identified as a MYC-interacting protein with features of a tumor suppressor. Isoforms that are expressed in the central nervous system may be involved in synaptic vesicle endocytosis and may interact with dynamin, synaptojanin, endophilin, and clathrin. Isoforms that are expressed in muscle and ubiquitously expressed isoforms localize to the cytoplasm and nucleus and activate a caspase-independent apoptotic process. Studies in mouse suggest that this gene plays an important role in cardiac muscle development. Alternate splicing of the gene results in several transcript variants encoding different isoforms. Aberrant splice variants expressed in tumor cell lines have also been described. provided by RefSeq, Mar 2016
Reviews
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Documents
Resources

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.