OriGene Logo

UBXN6 (NM_025241) Human 3' UTR Clone

Be the first to review this product
SKU
SC206878
3' UTR clone of UBX domain protein 6 (UBXN6) for miRNA target validation
  $683.00
4 Weeks*
Size
Bulk Requests & Clone Modifications

Frequently Bought Together (2)

CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA) 5 x 200 ul
$160.00
PR300001 Firefly luciferase assay kit, 150 assays 1 kit
$215.00

Other products for "UBXN6 or NM_025241"

Specifications
Specifications
Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Target Symbol UBXN6
Synonyms UBXD1; UBXDC2
ACCN NM_025241
Insert Size 522 bp
Sequence Data
Insert Sequence
>SC206878 3’UTR clone of NM_025241
The sequence shown below is from the reference sequence of NM_025241. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CTCCTGTCAGCCATCGAGAAGCTCTTGTGAAATAAAAGCAGGGTTGGCCTCAGCCCTGTGGGTCTGTCT
CATGCTCTCCCTGTTCCTCTCCCCGCCACCCCAGGGCCTCCAAGCCACCTCTGGAAATACTTGGCTCTG
CCCCATGGGCACGGGAGGGGCGCCAGCCGTGGAGCTGTGGAATTGGGCCCCGTGGCAGAGCCCCCATCC
CTTGGGGGCTGTGGGGATGCGCCCAAGCCCCCGAGGGAGAGGCCTGGGGACACCAACAAATCTAAGCCC
TCCCTAGCTGCTTGGTAACTGTGTCATGAAGCTGCCGGACAGACACACGTGGCATCTCCCTGGGCAGGA
GAGCAGGCCTGCAGCATGGGTCCTGTTCCCGTGTGCCGTGGGTGGCAGTGGCTGCACCTGGCACTAGGG
CTGCTCTGTGGATGTGGGTGACAACGGCAGGAGGGGATGCTGGCCTTCCTGCACATAGACCTGCAGTTA
GTAAATCATAAGCCCAAATAAACAGGTTGTTTGAATATA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI |
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_025241.3
Locus ID 80700
Summary May negatively regulate the ATPase activity of VCP, an ATP-driven segregase that associates with different cofactors to control a wide variety of cellular processes (PubMed:26475856). As a cofactor of VCP, it may play a role in the transport of CAV1 to lysosomes for degradation (PubMed:21822278, PubMed:23335559). It may also play a role in endoplasmic reticulum-associated degradation (ERAD) of misfolded proteins (PubMed:19275885). Together with VCP and other cofactors, it may play a role in macroautophagy, regulating for instance the clearance of damaged lysosomes (PubMed:27753622).[UniProtKB/Swiss-Prot Function]
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Documents
Resources

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.