OriGene Logo

OLFM2 (NM_058164) Human 3' UTR Clone

Be the first to review this product
SKU
SC206822
3' UTR clone of olfactomedin 2 (OLFM2) for miRNA target validation
  $683.00
4 Weeks*
Size
Bulk Requests & Clone Modifications

Frequently Bought Together (2)

CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA) 5 x 200 ul
$160.00
PR300001 Firefly luciferase assay kit, 150 assays 1 kit
$215.00

Other products for "OLFM2 or NM_058164"

Specifications
Specifications
Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Target Symbol OLFM2
Synonyms NOE2; NOELIN2; NOELIN2_V1; OlfC
ACCN NM_058164
Insert Size 498 bp
Sequence Data
Insert Sequence
>SC206822 3’UTR clone of NM_058164
The sequence shown below is from the reference sequence of NM_058164. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CACGTCATCAGCACCTCTGGGGACCCCTGAGCCAATGCTGTGGCTCGGGCTGCTGCCTGGGGGGCCTCT
GGGGGCTGGGGGCCCTTTTCATTCTGCCTGTGTCCCTCAAGGGTGATCTCTCTGTCTCTGTCACGCCCT
TTCTCCCCGCCTTTTTGCTGGGCTTTTGTTCTCTGCCTATGTATTTCTGTCTATTTTTTCAATTTCCCC
TCTTCTCCTTTATTGATCTCTGCTTTTAATACACCACTTCTTTCTTTCTGCCTTTTTATGGATGTCTTT
TTCTTTTTATGGCTCTGGTTCTCCAGTTCTTTCCGTCTCTGCCTCTCTCTGTCTCTCTCTCTCTGTCCT
TCCACCCCTCCCTCCTTGCTTCCCACCCATTCCTCATCCCTCACTCCCACCCCCACCCCCACCCCCAGG
AGTTGAGTGCATGGATCTGTTTCTTTTTTTATTTACACTTTTTCTTTCCGGTTTGCCGGAATAAACAGG
ACCTTTGACATTTGA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI |
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_058164.4
Locus ID 93145
Summary Involved in transforming growth factor beta (TGF-beta)-induced smooth muscle differentiation. TGF-beta induces expression and translocation of OLFM2 to the nucleus where it binds to SRF, causing its dissociation from the transcriptional repressor HEY2/HERP1 and facilitating binding of SRF to target genes (PubMed:25298399). Plays a role in AMPAR complex organization (By similarity). Is a regulator of vascular smooth-muscle cell (SMC) phenotypic switching, that acts by promoting RUNX2 and inhibiting MYOCD binding to SRF. SMC phenotypic switching is the process through which vascular SMCs undergo transition between a quiescent contractile phenotype and a proliferative synthetic phenotype in response to pathological stimuli. SMC phenotypic plasticity is essential for vascular development and remodeling (By similarity).UniProtKB/Swiss-Prot Function
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Documents
Resources

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.