B4GALT3 (NM_003779) Human 3' UTR Clone

SKU
SC206813
3' UTR clone of UDP-Gal:betaGlcNAc beta 14- galactosyltransferase polypeptide 3 (B4GALT3) for miRNA target validation
  $683.00
4 Weeks*
Specifications
Specifications
Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Target Symbol B4GALT3
Synonyms beta4Gal-T3
ACCN NM_003779
Insert Size 536 bp
Sequence Data
Insert Sequence
>SC206813 3’UTR clone of NM_003779
The sequence shown below is from the reference sequence of NM_003779. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
AACCACACAGCCCTCCGAGGTTCACACTGACTCCTCCTTCCTGTCTACCTTAATCATGAAACCGAATTC
ATGGGGTTGTATTCTCCCCACCCTCAGCTCCTCACTGTTCTCAGAGGGATGTGAGGGAACTGAACTCTG
GTGCCGTGCTAGGGGGTAGGGGCCTCTCCCTCACTGCTGGACTGGAGCTGGGCTCCTGTAGACCTGAGG
GGTCCCTCTCTCTAGGGTCTCCTGTAGGGCTTATGACTGTGAATCCTTGATGTCATGATTTTATGTGAC
GATTCCTAGGAGTCCCTGCCCCTAGAGTAGGAGCAGGGCTGGACCCCAAGCCCCTCCCTCTTCCATGGA
GAGAAGAGTGATCTGGCTTCTCCTCGGACCTCTGTGAATATTTATTCTATTTATGGTTCCCGGGAAGTT
GTTTGGTGAAGGAAGCCCCTCCCTGGGCATTTTCTGCCTATGCTGGAATAGCTCCCTCTTCTGGTCCTG
GCTCAGGGGGCTGGGATTTTGATATATTTTCTAATAAAGGACTTTGTCTCGCA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI |
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_003779.4
Locus ID 8703
Summary This gene is one of seven beta-1,4-galactosyltransferase (beta4GalT) genes. They encode type II membrane-bound glycoproteins that appear to have exclusive specificity for the donor substrate UDP-galactose; all transfer galactose in a beta1,4 linkage to similar acceptor sugars: GlcNAc, Glc, and Xyl. Each beta4GalT has a distinct function in the biosynthesis of different glycoconjugates and saccharide structures. As type II membrane proteins, they have an N-terminal hydrophobic signal sequence that directs the protein to the Golgi apparatus and which then remains uncleaved to function as a transmembrane anchor. By sequence similarity, the beta4GalTs form four groups: beta4GalT1 and beta4GalT2, beta4GalT3 and beta4GalT4, beta4GalT5 and beta4GalT6, and beta4GalT7. This gene encodes an enzyme that may be mainly involved in the synthesis of the first N-acetyllactosamine unit of poly-N-acetyllactosamine chains. Multiple alternatively spliced transcript variants encoding the same protein have been found for this gene. provided by RefSeq, Dec 2010
Reviews
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Documents
Resources

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.