OriGene Logo

RAB13 (NM_002870) Human 3' UTR Clone

Be the first to review this product
SKU
SC206811
3' UTR clone of RAB13 member RAS oncogene family (RAB13) for miRNA target validation
  $683.00
4 Weeks*
Size
Bulk Requests & Clone Modifications

Frequently Bought Together (2)

CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA) 5 x 200 ul
$160.00
PR300001 Firefly luciferase assay kit, 150 assays 1 kit
$215.00

Other products for "RAB13 or NM_002870"

Specifications
Specifications
Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Target Symbol RAB13
Synonyms GIG4
ACCN NM_002870
Insert Size 479 bp
Sequence Data
Insert Sequence
>SC206811 3’UTR clone of NM_002870
The sequence shown below is from the reference sequence of NM_002870. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
AAGAACACCAACAAGTGCTCCCTGGGCTGAGGACCCTTTCTTGCCTCCCCACCCCGGAAGCTGAACCTG
AGGGAGACAACGGCAGAGGGAGTGAGCAGGGGAGAAATAGCAGAGGGGCTTGGAGGGTCACATAGGTAG
ATGGTAAAGAGAATGAGGAGAAAAAGGAGAAAAGGGAAAAGCAGAAAGGAAAAAAAGGAAGAGAGAGGA
AGGGAGAAGGGAGAGGAATGAATTGAGGAAGTGAAAGAAGGCAAGGAGGTAGGAAGAGAGGGAGGAGGA
AAGGAAGGAGAGATGCCTCAGGCTTCAGACCTTACCTGGGTTTTCAGGGCAAACATAAATGTAAATACA
CTGATTTATTCTGTTACTAGATCAGGTTTTAGGGTCCTGCAAAAGGCTAGCTCGGCACTACACTAGGGA
ATTTGCTCCTGTTCTGTCACTTGTCATGGTCTTTCTTGGTATTAAAGGCCACCATTTGCACAAAT
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI |
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_002870.5
Locus ID 5872
Summary This gene is a member of the Rab family of small G proteins and plays a role in regulating membrane trafficking between trans-Golgi network (TGN) and recycling endosomes (RE). The encoded protein is involved in the assembly of tight junctions, which are components of the apical junctional complex (AJC) of epithelial cells. The AJC plays a role in forming a barrier between luminal contents and the underlying tissue. Additional functions associated with the protein include endocytic recycling of occludin, regulation of epithelial cell scattering, neuronal regeneration and regulation of neurite outgrowth. Alternately spliced transcript variants have been observed for this gene. A pseudogene associated with this gene is located on chromosome 12. provided by RefSeq, Jan 2013
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Documents
Resources

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.