OriGene Logo

RRBP1 (NM_001042576) Human 3' UTR Clone

Be the first to review this product
SKU
SC206805
3' UTR clone of ribosome binding protein 1 homolog 180kDa (dog) (RRBP1) transcript variant 1 for miRNA target validation
  $683.00
4 Weeks*
Size
Bulk Requests & Clone Modifications

Frequently Bought Together (2)

CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA) 5 x 200 ul
$160.00
PR300001 Firefly luciferase assay kit, 150 assays 1 kit
$215.00

Other products for "RRBP1 or NM_001042576"

Specifications
Specifications
Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Target Symbol RRBP1
Synonyms ES/130; ES130; hES; p180; RRp
ACCN NM_001042576
Insert Size 533 bp
Sequence Data
Insert Sequence
>SC206805 3’UTR clone of NM_001042576
The sequence shown below is from the reference sequence of NM_001042576. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
AGCAGCTCAAAGGAGGGCACCTCTGTCTGAGTTTCCTCTTTGGAAAAAGAAGTTACTGTTCAACTTACC
AAAATGCCTTACACATTCCTTACAAATAAACCAACCAACCTACACAGCGTTATCCAGGCCCAACTTCCG
GTAGCTCCGAGAGAAGCCATGAGAGACAAGTCTCTTAGAGCCACAGAAGTAGACCTTCCAGAGCCCCAG
TTTGTAAATGAACCTGTGTCACATTTGATAAACACTATCCTGGGCGCAGCCCCGGGCCACCGCCGAGTG
ACGCCAAAGCCCTGGTTGACTCTGACAGCCCCGTGGGTGTGTGGGAGGCCGGGCGCTCTGGGGTCTGTC
TGTCAGTGCAATCGTTTAGTGTTTTTTCAGTGGGGCGGGGCGGGAAGCGGGTGGGACCGGGCAGCCAGT
TCTCAAAGGCTGTGGGGCCGACTGGAGGCCACAGCCCCTCACCCCTAGACGTTGCCAACCAGAACTGAC
GTGTGACCTCCTGGGTGTTGATGCCATTAAAACCAACGTTGGTGCCCGGT
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI |
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001042576.2
Locus ID 6238
Summary This gene encodes a ribosome-binding protein of the endoplasmic reticulum (ER) membrane. Studies suggest that this gene plays a role in ER proliferation, secretory pathways and secretory cell differentiation, and mediation of ER-microtubule interactions. Alternative splicing has been observed and protein isoforms are characterized by regions of N-terminal decapeptide and C-terminal heptad repeats. Splicing of the tandem repeats results in variations in ribosome-binding affinity and secretory function. The full-length nature of variants which differ in repeat length has not been determined. Pseudogenes of this gene have been identified on chromosomes 3 and 7, and RRBP1 has been excluded as a candidate gene in the cause of Alagille syndrome, the result of a mutation in a nearby gene on chromosome 20p12. provided by RefSeq, Apr 2012
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Documents
Resources

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.