ZDHHC16 (NM_198045) Human 3' UTR Clone

SKU
SC206802
3' UTR clone of zinc finger DHHC-type containing 16 (ZDHHC16) transcript variant 4 for miRNA target validation
  $683.00
4 Weeks*
Specifications
Specifications
Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Target Symbol ZDHHC16
Synonyms APH2; DHHC-16
ACCN NM_198045
Insert Size 509 bp
Sequence Data
Insert Sequence
>SC206802 3’UTR clone of NM_198045
The sequence shown below is from the reference sequence of NM_198045. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GCTCACTCAGCCTCTGTGATGGCAGTGTGAGCTGGACTGTGTCAGCCACGACTCGAGCACTCATTCTGC
TCCCTATGTTATTTCAAGGGCCTCCAAGGGCAGCTTTTCTCAGAATCCTTGATCAAAAAGAGCCAGTGG
GCCTGCCTTAGGGTACCATGCAGGACAATTCAAGGACCAGCCTTTTTACCACTGCAGAAGAAAGACACA
ATGTGGAGAAATCTTAGGACTGACATCCCTTTACTCAGGCAAACAGAAGTTCCAACCCCAGACTAGGGG
TCAGGCAGCTAGCTACCTACCTTGCCCAGTGCTGACCCGGACCTCCTCCAGGATACAGCACTGGAGTTG
GCCACCACCTCTTCTACTTGCTGTCTGAAAAAACACCTGACTAGTACAGCTGAGATCTTGGCTTCTCAA
CAGGGCAAAGATACCAGGCCTGCTGCTGAGGTCACTGCCACTTCTCACATGCTGCTTAAGGGAGCACAA
ATAAAGGTATTCGATTTTTAAAGATA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI |
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_198045.3
Locus ID 84287
Summary Palmitoyl acyltransferase that mediates palmitoylation of proteins such as PLN and ZDHHC6 (PubMed:28826475). Required during embryonic heart development and cardiac function, possibly by mediating palmitoylation of PLN, thereby affecting PLN phosphorylation and homooligomerization (By similarity). Also required for eye development (By similarity). Palmitoylates ZDHHC6, affecting the quaternary assembly of ZDHHC6, its localization, stability and function (PubMed:28826475). May play a role in DNA damage response (By similarity). May be involved in apoptosis regulation (By similarity). Involved in the proliferation of neural stem cells by regulating the FGF/ERK pathway (By similarity).[UniProtKB/Swiss-Prot Function]
Reviews
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Documents
Resources

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.