OriGene Logo

EEF1E1 (NM_004280) Human 3' UTR Clone

Be the first to review this product
SKU
SC206795
3' UTR clone of eukaryotic translation elongation factor 1 epsilon 1 (EEF1E1) transcript variant 1 for miRNA target validation
  $683.00
4 Weeks*
Size
Bulk Requests & Clone Modifications

Frequently Bought Together (2)

CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA) 5 x 200 ul
$160.00
PR300001 Firefly luciferase assay kit, 150 assays 1 kit
$215.00

Other products for "EEF1E1 or NM_004280"

Specifications
Specifications
Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Target Symbol EEF1E1
Synonyms AIMP3; P18
ACCN NM_004280
Insert Size 525 bp
Sequence Data
Insert Sequence
>SC206795 3’UTR clone of NM_004280
The sequence shown below is from the reference sequence of NM_004280. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
AAGAACAGACTATATACTAATTCCCACTAGAAGCTGTCCATGCCATACAGAAGATCTATTAAAAATGTT
TTAAATGGAAAATGTACTCTAGACCACAGGACTAATGTAAATTAATATACAGTCATTCATTATTTGTTG
AAGTTGATAGAATTTTTGAAGTGTAAACTTGTGTCTGAATGTTTTATTTGTTCTTTAGCTGAAGTTTTG
CAATTTTTATGTCAAAATTCAATTGCTATTAAACAAGTTGAGATCCAGTTATAAATTAACCTTGTTTTT
AGTAGATGACATTTATTTCAATAAAAGTTGCAAATCGGGCTTAATCTTAAAATTGGTGGTCATTTCAAT
GGTTGACATATTTGGCTATTTATTAACCTCTCTTTCATATTCTAAAATTCATTTTCCCCTTATGGATAT
TTATGGTAGTTTGTTAAGAACTGATAAATTGTGCCAAGGAAGCCAAAAGGGAAGACAGATGGATTTGTT
TTAAAATATTTATGTGAGCTAGTAAATGTGGTTGAAAAAATA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI |
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_004280.5
Locus ID 9521
Summary This gene encodes a multifunctional protein that localizes to both the cytoplasm and nucleus. In the cytoplasm, the encoded protein is an auxiliary component of the macromolecular aminoacyl-tRNA synthase complex. However, its mouse homolog has been shown to translocate to the nucleus in response to DNA damage, and it plays a positive role in ATM/ATR-mediated p53 activation. Alternative splicing results in multiple transcript variants. Read-through transcription also exists between this gene and the neighboring downstream MUTED (muted homolog) gene. An EEF1E1-related pseudogene has been identified on chromosome 2. provided by RefSeq, Dec 2010
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Documents
Resources

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.