PSG3 (NM_021016) Human 3' UTR Clone

SKU
SC206794
3' UTR clone of pregnancy specific beta-1-glycoprotein 3 (PSG3) for miRNA target validation
  $683.00
4 Weeks*
Specifications
Specifications
Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Target Symbol PSG3
ACCN NM_021016
Insert Size 519 bp
Sequence Data
Insert Sequence
>SC206794 3’UTR clone of NM_021016
The sequence shown below is from the reference sequence of NM_021016. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GGACATCTTCCTGGCCTTAATCCATTATAGCAGCCGTGATGTCATTTCTGTATTTCAGGAAGACTGGCA
GACAGTTGCTTTCATTCTTCCTCAAAGTATTTACCATCAGCTACAGTCCAAAATTGCTTTTTGTTCAAG
GAGATTTATGAAAAGACTCTGACAAGGACTCTTGAATACAAGTTCCTGATAACTTCAAGATCATACCAC
TGGACTAAGAACTTTCAAAATTTTAATGAACAGGCTGATACTTCATGAAATTCAAGACAAAGAAAAAAA
CCCAATTTTATTGGACTAAATAGTCAAAACAATGTTTTCATAATTTTCTATTTGAAAATGTGCTGATTC
TTTGAATGTTTTATTCTCCAGATTTATGCACTTTTTTTCTTCAGCAATTGGTAAAGTATACTTTTGTAA
ACAAAAATTGAAACATTTGCTTTTGCTCCCTAAGTGCCCCAGAATTGGGAAACTATTCAGGAGTATTCA
TATGTTTATGGTAATAAAGTTATCTGCACAAGTTCA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI |
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_021016.4
Locus ID 5671
Summary The human pregnancy-specific glycoproteins (PSGs) are a family of proteins that are synthesized in large amounts by placental trophoblasts and released into the maternal circulation during pregnancy. Molecular cloning and analysis of several PSG genes has indicated that the PSGs form a subgroup of the carcinoembryonic antigen (CEA) gene family, which belongs to the immunoglobulin superfamily of genes. Members of the CEA family consist of a single N domain, with structural similarity to the immunoglobulin variable domains, followed by a variable number of immunoglobulin constant-like A and/or B domains. Most PSGs have an arg-gly-asp (RGD) motif, which has been shown to function as an adhesion recognition signal for several integrins, in the N-terminal domain (summary by Teglund et al., 1994 [PubMed 7851896]). For additional general information about the PSG gene family, see PSG1 (MIM 176390).[supplied by OMIM, Oct 2009]
Reviews
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Documents
Resources

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.