PSMB5 (NM_001144932) Human 3' UTR Clone

SKU
SC206779
3' UTR clone of proteasome (prosome macropain) subunit beta type 5 (PSMB5) transcript variant 3 for miRNA target validation
  $683.00
4 Weeks*
Specifications
Specifications
Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Target Symbol PSMB5
Synonyms LMPX; MB1; X
ACCN NM_001144932
Insert Size 528 bp
Sequence Data
Insert Sequence
>SC206779 3’UTR clone of NM_001144932
The sequence shown below is from the reference sequence of NM_001144932. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
ATGGCAAGGCCTCTACTACGTGGACAGTGAAGGGAACCGGATTTCAGGGGCCACCTTCTCTGTAGGTTC
TGGCTCTGTGTATGCATATGGGGTCATGGATCGGGGCTATTCCTATGACCTGGAAGTGGAGCAGGCCTA
TGATCTGGCCCGTCGAGCCATCTACCAAGCCACCTACAGAGATGCCTACTCAGGAGGTGCAGTCAACCT
CTACCACGTGCGGGAGGATGGCTGGATCCGAGTCTCCAGTGACAATGTGGCTGATCTACATGAGAAGTA
TAGTGGCTCTACCCCCTGAAAGAGGGTGGATGCAGCTGCTTGTGTTTCTTGGGGTGACTGTCATTGGTA
ATACGGACACAGTGACCCATCCTCCATCCTATTTATAGTGGAAGGGCCTTCAATTGTATCAGTACTTTT
TTTTAAGCTCTGGCACATTGACCTCTATGTGTTACCAGTCATTAATGAGCTGCTGCAGAGGTGACTATT
TGTTTTACTTTCTTGGATGTTAACATTACACTACTCACTACTCAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI |
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_001144932.3
Locus ID 5693
Summary The proteasome is a multicatalytic proteinase complex with a highly ordered ring-shaped 20S core structure. The core structure is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. This gene encodes a member of the proteasome B-type family, also known as the T1B family, that is a 20S core beta subunit in the proteasome. This catalytic subunit is not present in the immunoproteasome and is replaced by catalytic subunit 3i (proteasome beta 8 subunit). Multiple transcript variants encoding different isoforms have been found for this gene. provided by RefSeq, Jan 2009
Reviews
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Documents
Resources

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.