OriGene Logo

NEK3 (NM_152720) Human 3' UTR Clone

Be the first to review this product
SKU
SC206730
3' UTR clone of NIMA (never in mitosis gene a)-related kinase 3 (NEK3) transcript variant 2 for miRNA target validation
  $683.00
4 Weeks*
Size
Bulk Requests & Clone Modifications

Frequently Bought Together (2)

CC100003 DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA) 5 x 200 ul
$160.00
PR300001 Firefly luciferase assay kit, 150 assays 1 kit
$215.00

Other products for "NEK3 or NM_152720"

Specifications
Specifications
Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Target Symbol NEK3
Synonyms HSPK36
ACCN NM_152720
Insert Size 525 bp
Sequence Data
Insert Sequence
>SC206730 3’UTR clone of NM_152720
The sequence shown below is from the reference sequence of NM_152720. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GCTGGATGGCAAGGCCTGTGCGACAGATAATGCCTGAGGAAATGTTCCTGAGTCACGCTGAGGAGAGGC
TTCACTCAGGAGTTCATGCTGAGATGATCATGAGTTCATGCGACGTATATTTTCCTTTGGAAACAGAAT
GAAGCAGAGGAAACTCTTAATACTTAAAATCGTTCTTGATTAGTATCGTGAGTTTGAAAAGTCTAGAAC
TCCTGTAAGTTTTTGAACTCAAGGGAGAAGGTATAGTGGAATGAGTGTGAGCATCGGGCTTTGCAGTCC
CATAGAACAGAAATGGGATGCTAGCGTGCCACTACCTACTTGTGTGATTGTGGGAAATTACTTAACCTC
TTCAAGCCCCAATTTCCTCAACCATAAAATGAAGATAATAATGCCTACCTCAGAGGGATGCTGACCACA
GACCTTTATAGCAGCCCGTATGATATTATTCACATTATGATATGTGTTTATTATTATGTGACTCTTTTT
ACATTTCCTAAAGGTTTGAGAATTAAATATATTTAATTATGA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI |
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Shipping Ambient
Reference Data
RefSeq NM_152720.3
Locus ID 4752
Summary This gene encodes a member of the NimA (never in mitosis A) family of serine/threonine protein kinases. The encoded protein differs from other NimA family members in that it is not cell cycle regulated and is found primarily in the cytoplasm. The kinase is activated by prolactin stimulation, leading to phosphorylation of VAV2 guanine nucleotide exchange factor, paxillin, and activation of the RAC1 GTPase. Two functional alleles for this gene have been identified in humans. The reference genome assembly (GRCh38) represents a functional allele that is associated with the inclusion of an additional coding exon in protein-coding transcripts, compared to an alternate functional allele that lacks the exon. provided by RefSeq, Sep 2019
Reviews
Write Review
 
 
 
 
 

Be the first to review this product

Please note:
Only reviews with images are eligible for a $20/20€ Amazon gift card.
Reviews without images are eligible for a $10/10€ Amazon gift card.
For more details about the terms and conditions, please visit the promotion page.

Documents
Resources

file-alt Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.